Incidental Mutation 'R6689:Lgr5'
ID527891
Institutional Source Beutler Lab
Gene Symbol Lgr5
Ensembl Gene ENSMUSG00000020140
Gene Nameleucine rich repeat containing G protein coupled receptor 5
SynonymsGpr49
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_010195.2; MGI: 1341817

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6689 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location115450311-115587780 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 115466608 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 293 (I293F)
Ref Sequence ENSEMBL: ENSMUSP00000020350 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020350] [ENSMUST00000172806] [ENSMUST00000173740]
Predicted Effect probably damaging
Transcript: ENSMUST00000020350
AA Change: I293F

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000020350
Gene: ENSMUSG00000020140
AA Change: I293F

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
LRRNT 33 70 1.43e-5 SMART
LRR 64 88 1.41e2 SMART
LRR_TYP 89 112 3.44e-4 SMART
LRR_TYP 113 136 9.88e-5 SMART
LRR_TYP 137 160 9.73e-4 SMART
LRR_TYP 161 184 5.21e-4 SMART
LRR 185 208 6.22e0 SMART
LRR_TYP 209 232 3.89e-3 SMART
LRR 233 255 9.75e0 SMART
LRR_TYP 256 279 1.38e-3 SMART
Blast:LRR 281 303 2e-6 BLAST
Blast:LRR 304 328 1e-5 BLAST
LRR_TYP 351 374 1.56e-2 SMART
LRR 375 396 1.09e2 SMART
LRR_TYP 397 420 7.26e-3 SMART
LRR 421 444 2.86e-1 SMART
low complexity region 518 533 N/A INTRINSIC
Pfam:7tm_1 574 820 9.5e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000105272
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144732
Predicted Effect probably damaging
Transcript: ENSMUST00000172806
AA Change: I269F

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000133860
Gene: ENSMUSG00000020140
AA Change: I269F

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
LRRNT 33 70 1.43e-5 SMART
LRR 64 88 1.41e2 SMART
LRR_TYP 89 112 3.44e-4 SMART
LRR_TYP 113 136 9.88e-5 SMART
LRR_TYP 137 160 9.73e-4 SMART
LRR_TYP 161 184 5.21e-4 SMART
LRR 185 208 6.22e0 SMART
LRR_TYP 209 232 3.89e-3 SMART
LRR 233 255 9.75e0 SMART
LRR 256 279 6.57e-1 SMART
Blast:LRR 280 304 1e-5 BLAST
LRR_TYP 327 350 1.56e-2 SMART
LRR 351 372 1.09e2 SMART
LRR_TYP 373 396 7.26e-3 SMART
LRR 397 420 2.86e-1 SMART
low complexity region 494 509 N/A INTRINSIC
Pfam:7tm_1 550 796 8.2e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000173740
AA Change: I221F

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000133707
Gene: ENSMUSG00000020140
AA Change: I221F

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
LRRNT 33 70 1.43e-5 SMART
LRR 64 88 1.41e2 SMART
LRR_TYP 89 112 3.44e-4 SMART
LRR_TYP 113 136 9.88e-5 SMART
LRR_TYP 137 160 9.08e-4 SMART
LRR 161 183 9.75e0 SMART
LRR_TYP 184 207 1.38e-3 SMART
Blast:LRR 209 231 1e-6 BLAST
Blast:LRR 232 256 1e-5 BLAST
LRR_TYP 279 302 1.56e-2 SMART
LRR 303 324 1.09e2 SMART
LRR_TYP 325 348 7.26e-3 SMART
LRR 349 372 2.86e-1 SMART
low complexity region 446 461 N/A INTRINSIC
Pfam:7tm_1 502 748 7.4e-16 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency
MGI Phenotype Strain: 3512420
Lethality: D1-D2
FUNCTION: The protein encoded by this gene is a leucine-rich repeat-containing receptor (LGR) and member of the G protein-coupled, 7-transmembrane receptor (GPCR) superfamily. The encoded protein is a receptor for R-spondins and is involved in the canonical Wnt signaling pathway. This protein plays a role in the formation and maintenance of adult intestinal stem cells during postembryonic development. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele display 100% neonatal lethality associated with ankyloglossia, gastrointestinal distension, cyanosis and respiratory failure. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted(7)

Other mutations in this stock
Total: 16 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921507P07Rik A G 6: 50,589,109 probably null Het
Ankk1 T A 9: 49,420,476 I173F probably damaging Het
Aurka A G 2: 172,370,393 probably null Het
B4galnt4 C T 7: 141,067,984 T471I probably benign Het
Commd6 C A 14: 101,640,459 probably benign Het
Cyr61 T A 3: 145,647,788 M340L probably benign Het
Elobl T C 11: 88,965,093 N48S possibly damaging Het
Grem1 T C 2: 113,749,931 E75G probably benign Het
Hp C T 8: 109,575,720 V199I probably benign Het
Kcna2 C A 3: 107,105,027 S308Y probably damaging Het
Lmln A G 16: 33,104,782 R462G probably benign Het
Lsm3 GATATATA GATATATATA 6: 91,519,635 probably null Het
Mroh4 A G 15: 74,612,003 V495A probably damaging Het
Olfr1100 A G 2: 86,978,154 I214T probably benign Het
Olfr95 C G 17: 37,211,157 G232A probably damaging Het
Stim2 G A 5: 54,115,976 R524H probably damaging Het
Other mutations in Lgr5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Lgr5 APN 10 115454464 missense possibly damaging 0.69
IGL01291:Lgr5 APN 10 115478534 missense probably damaging 1.00
IGL01432:Lgr5 APN 10 115453092 missense probably damaging 1.00
IGL01778:Lgr5 APN 10 115462702 missense probably damaging 0.97
IGL01936:Lgr5 APN 10 115452414 missense probably damaging 1.00
IGL02079:Lgr5 APN 10 115452194 missense probably damaging 1.00
IGL02134:Lgr5 APN 10 115452858 missense possibly damaging 0.89
IGL03083:Lgr5 APN 10 115453032 missense probably benign 0.26
IGL03350:Lgr5 APN 10 115471988 missense probably damaging 0.99
anger UTSW 10 115466346 missense probably benign 0.03
ANU05:Lgr5 UTSW 10 115478534 missense probably damaging 1.00
R0378:Lgr5 UTSW 10 115454499 missense probably damaging 1.00
R0788:Lgr5 UTSW 10 115452997 missense probably damaging 0.99
R1119:Lgr5 UTSW 10 115460811 critical splice donor site probably null
R1321:Lgr5 UTSW 10 115478457 missense probably damaging 1.00
R1880:Lgr5 UTSW 10 115452279 missense probably damaging 1.00
R1985:Lgr5 UTSW 10 115495245 splice site probably benign
R2434:Lgr5 UTSW 10 115587406 missense probably benign
R3055:Lgr5 UTSW 10 115466123 splice site probably benign
R3910:Lgr5 UTSW 10 115587463 missense possibly damaging 0.93
R4686:Lgr5 UTSW 10 115458743 intron probably benign
R4862:Lgr5 UTSW 10 115462764 missense probably damaging 1.00
R4866:Lgr5 UTSW 10 115452685 missense probably benign 0.00
R5089:Lgr5 UTSW 10 115478423 missense probably damaging 1.00
R5118:Lgr5 UTSW 10 115452339 missense possibly damaging 0.88
R5375:Lgr5 UTSW 10 115478564 missense probably benign 0.00
R5537:Lgr5 UTSW 10 115456689 missense probably benign 0.00
R5583:Lgr5 UTSW 10 115478504 missense probably benign 0.32
R6312:Lgr5 UTSW 10 115452924 missense probably damaging 1.00
R6362:Lgr5 UTSW 10 115478525 missense probably damaging 1.00
R6605:Lgr5 UTSW 10 115457867 missense possibly damaging 0.69
R6705:Lgr5 UTSW 10 115587288 missense probably damaging 0.96
R6925:Lgr5 UTSW 10 115466346 missense probably benign 0.03
R7063:Lgr5 UTSW 10 115456734 missense probably damaging 1.00
R7261:Lgr5 UTSW 10 115587465 missense possibly damaging 0.96
R7274:Lgr5 UTSW 10 115452505 missense probably damaging 0.99
R7458:Lgr5 UTSW 10 115457755 critical splice donor site probably null
R7569:Lgr5 UTSW 10 115462756 missense probably damaging 1.00
R7770:Lgr5 UTSW 10 115471994 missense probably damaging 0.98
Z1176:Lgr5 UTSW 10 115460876 missense not run
Z1177:Lgr5 UTSW 10 115456669 missense not run
Predicted Primers PCR Primer
(F):5'- GAGGCACCATTCAAAGTCCTAG -3'
(R):5'- GGAGACACTTTCAATGTTCACTTG -3'

Sequencing Primer
(F):5'- CCATTCAAAGTCCTAGGAGAAATGTG -3'
(R):5'- GTTCACTTGAAACTGAGTAACCGG -3'
Posted On2018-07-23