Incidental Mutation 'R6689:Elobl'
ID527892
Institutional Source Beutler Lab
Gene Symbol Elobl
Ensembl Gene ENSMUSG00000057534
Gene Nameelongin B-like
SynonymsGm15698, Tceb2l
MMRRC Submission
Accession Numbers
Is this an essential gene? Not available question?
Stock #R6689 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location88964658-88966931 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 88965093 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 48 (N48S)
Ref Sequence ENSEMBL: ENSMUSP00000113104 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061938] [ENSMUST00000082339] [ENSMUST00000121228]
Predicted Effect possibly damaging
Transcript: ENSMUST00000061938
AA Change: N48S

PolyPhen 2 Score 0.732 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000103534
Gene: ENSMUSG00000057534
AA Change: N48S

DomainStartEndE-ValueType
UBQ 1 80 3.24e-4 SMART
low complexity region 95 103 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000082339
AA Change: N56S

PolyPhen 2 Score 0.189 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000080951
Gene: ENSMUSG00000057534
AA Change: N56S

DomainStartEndE-ValueType
UBQ 9 88 3.24e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000121228
AA Change: N48S

PolyPhen 2 Score 0.732 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000113104
Gene: ENSMUSG00000057534
AA Change: N48S

DomainStartEndE-ValueType
UBQ 1 80 3.24e-4 SMART
low complexity region 95 103 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 16 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921507P07Rik A G 6: 50,589,109 probably null Het
Ankk1 T A 9: 49,420,476 I173F probably damaging Het
Aurka A G 2: 172,370,393 probably null Het
B4galnt4 C T 7: 141,067,984 T471I probably benign Het
Commd6 C A 14: 101,640,459 probably benign Het
Cyr61 T A 3: 145,647,788 M340L probably benign Het
Grem1 T C 2: 113,749,931 E75G probably benign Het
Hp C T 8: 109,575,720 V199I probably benign Het
Kcna2 C A 3: 107,105,027 S308Y probably damaging Het
Lgr5 T A 10: 115,466,608 I293F probably damaging Het
Lmln A G 16: 33,104,782 R462G probably benign Het
Lsm3 GATATATA GATATATATA 6: 91,519,635 probably null Het
Mroh4 A G 15: 74,612,003 V495A probably damaging Het
Olfr1100 A G 2: 86,978,154 I214T probably benign Het
Olfr95 C G 17: 37,211,157 G232A probably damaging Het
Stim2 G A 5: 54,115,976 R524H probably damaging Het
Other mutations in Elobl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02930:Elobl APN 11 88965186 missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- GTTCATTAGCAGGGTCCTCATC -3'
(R):5'- ACACTTCTCAGGTCCAGTGAG -3'

Sequencing Primer
(F):5'- CAGGGTCCTCATCAAAAAGTGGTTC -3'
(R):5'- TCCAGTGAGGTGCCTGGAG -3'
Posted On2018-07-23