Incidental Mutation 'R6689:Commd6'
List |< first << previous [record 5 of 17] next >> last >|
ID527893
Institutional Source Beutler Lab
Gene Symbol Commd6
Ensembl Gene ENSMUSG00000075486
Gene NameCOMM domain containing 6
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.217) question?
Stock #R6689 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location101632981-101640686 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to A at 101640459 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000131634 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100339] [ENSMUST00000168587]
Predicted Effect probably benign
Transcript: ENSMUST00000100339
SMART Domains Protein: ENSMUSP00000097912
Gene: ENSMUSG00000075486

DomainStartEndE-ValueType
Pfam:HCaRG 7 86 6.4e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131022
Predicted Effect probably benign
Transcript: ENSMUST00000168587
SMART Domains Protein: ENSMUSP00000131634
Gene: ENSMUSG00000075486

DomainStartEndE-ValueType
Pfam:HCaRG 5 83 3.3e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227868
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 16 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921507P07Rik A G 6: 50,589,109 probably null Het
Ankk1 T A 9: 49,420,476 I173F probably damaging Het
Aurka A G 2: 172,370,393 probably null Het
B4galnt4 C T 7: 141,067,984 T471I probably benign Het
Cyr61 T A 3: 145,647,788 M340L probably benign Het
Elobl T C 11: 88,965,093 N48S possibly damaging Het
Grem1 T C 2: 113,749,931 E75G probably benign Het
Hp C T 8: 109,575,720 V199I probably benign Het
Kcna2 C A 3: 107,105,027 S308Y probably damaging Het
Lgr5 T A 10: 115,466,608 I293F probably damaging Het
Lmln A G 16: 33,104,782 R462G probably benign Het
Lsm3 GATATATA GATATATATA 6: 91,519,635 probably null Het
Mroh4 A G 15: 74,612,003 V495A probably damaging Het
Olfr1100 A G 2: 86,978,154 I214T probably benign Het
Olfr95 C G 17: 37,211,157 G232A probably damaging Het
Stim2 G A 5: 54,115,976 R524H probably damaging Het
Other mutations in Commd6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01324:Commd6 APN 14 101640302 intron probably benign
IGL02469:Commd6 APN 14 101637027 missense probably damaging 1.00
IGL03405:Commd6 APN 14 101637072 missense probably damaging 1.00
R0008:Commd6 UTSW 14 101640273 intron probably benign
R4676:Commd6 UTSW 14 101640284 intron probably benign
R6841:Commd6 UTSW 14 101637098 missense probably damaging 1.00
R6875:Commd6 UTSW 14 101634350 missense probably damaging 0.98
R6983:Commd6 UTSW 14 101637052 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGTTTAAGTGACAGCCAC -3'
(R):5'- ATCCTGGATGTCACGAGTCC -3'

Sequencing Primer
(F):5'- ATCCCCTCGGGTGCAAGAG -3'
(R):5'- TGGATGTCACGAGTCCTCCAC -3'
Posted On2018-07-23