Incidental Mutation 'R6689:Lmln'
List |< first << previous [record 12 of 17] next >> last >|
ID527895
Institutional Source Beutler Lab
Gene Symbol Lmln
Ensembl Gene ENSMUSG00000022802
Gene Nameleishmanolysin-like (metallopeptidase M8 family)
Synonyms5330415H22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.118) question?
Stock #R6689 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location33062521-33127695 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 33104782 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 462 (R462G)
Ref Sequence ENSEMBL: ENSMUSP00000023497 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023497]
Predicted Effect probably benign
Transcript: ENSMUST00000023497
AA Change: R462G

PolyPhen 2 Score 0.195 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000023497
Gene: ENSMUSG00000022802
AA Change: R462G

DomainStartEndE-ValueType
signal peptide 1 42 N/A INTRINSIC
Pfam:Peptidase_M8 154 289 3.9e-16 PFAM
Pfam:Peptidase_M8 295 633 5.2e-54 PFAM
transmembrane domain 658 680 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000105610
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153549
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158235
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a zinc-metallopeptidase. The encoded protein may play a role in cell migration and invasion. Studies of a similar protein in Drosophila indicate a potential role in mitotic progression. Alternatively spliced transcript variants have been described. [provided by RefSeq, Feb 2009]
Allele List at MGI
Other mutations in this stock
Total: 16 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921507P07Rik A G 6: 50,589,109 probably null Het
Ankk1 T A 9: 49,420,476 I173F probably damaging Het
Aurka A G 2: 172,370,393 probably null Het
B4galnt4 C T 7: 141,067,984 T471I probably benign Het
Commd6 C A 14: 101,640,459 probably benign Het
Cyr61 T A 3: 145,647,788 M340L probably benign Het
Elobl T C 11: 88,965,093 N48S possibly damaging Het
Grem1 T C 2: 113,749,931 E75G probably benign Het
Hp C T 8: 109,575,720 V199I probably benign Het
Kcna2 C A 3: 107,105,027 S308Y probably damaging Het
Lgr5 T A 10: 115,466,608 I293F probably damaging Het
Lsm3 GATATATA GATATATATA 6: 91,519,635 probably null Het
Mroh4 A G 15: 74,612,003 V495A probably damaging Het
Olfr1100 A G 2: 86,978,154 I214T probably benign Het
Olfr95 C G 17: 37,211,157 G232A probably damaging Het
Stim2 G A 5: 54,115,976 R524H probably damaging Het
Other mutations in Lmln
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Lmln APN 16 33083065 missense probably benign 0.08
IGL01346:Lmln APN 16 33117120 missense probably benign 0.00
IGL01664:Lmln APN 16 33080987 missense probably benign 0.03
nemeth UTSW 16 33074097 nonsense probably null
R0234:Lmln UTSW 16 33066324 missense probably damaging 0.99
R0234:Lmln UTSW 16 33066324 missense probably damaging 0.99
R0562:Lmln UTSW 16 33117085 nonsense probably null
R1017:Lmln UTSW 16 33088176 missense probably benign
R1557:Lmln UTSW 16 33088211 missense probably benign 0.25
R1617:Lmln UTSW 16 33117130 missense probably damaging 1.00
R2211:Lmln UTSW 16 33109778 missense probably benign 0.00
R4061:Lmln UTSW 16 33066391 nonsense probably null
R4414:Lmln UTSW 16 33109850 missense probably benign 0.00
R4512:Lmln UTSW 16 33088137 missense probably benign 0.01
R4564:Lmln UTSW 16 33109856 missense probably benign 0.09
R4995:Lmln UTSW 16 33074097 nonsense probably null
R5044:Lmln UTSW 16 33074180 missense possibly damaging 0.80
R6109:Lmln UTSW 16 33069111 missense possibly damaging 0.69
R6287:Lmln UTSW 16 33074185 critical splice donor site probably null
R6577:Lmln UTSW 16 33107000 splice site probably null
R7079:Lmln UTSW 16 33067291 missense probably benign 0.02
R7432:Lmln UTSW 16 33089368 missense probably damaging 1.00
R7807:Lmln UTSW 16 33107131 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GGCAGTCTCAGTAAAGGACTTG -3'
(R):5'- TTGACTCGAGGCACAGCTAG -3'

Sequencing Primer
(F):5'- CAAGAGGCCGTTGACATA -3'
(R):5'- CTCGTGTTACCTGGTACT -3'
Posted On2018-07-23