Incidental Mutation 'R6692:Fam168b'
ID527897
Institutional Source Beutler Lab
Gene Symbol Fam168b
Ensembl Gene ENSMUSG00000037503
Gene Namefamily with sequence similarity 168, member B
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R6692 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location34813219-34843065 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 34836741 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Valine at position 21 (G21V)
Ref Sequence ENSEMBL: ENSMUSP00000139456 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047534] [ENSMUST00000167518] [ENSMUST00000170092] [ENSMUST00000185231] [ENSMUST00000185469] [ENSMUST00000191307]
Predicted Effect possibly damaging
Transcript: ENSMUST00000047534
AA Change: G21V

PolyPhen 2 Score 0.807 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000042212
Gene: ENSMUSG00000037503
AA Change: G21V

DomainStartEndE-ValueType
Pfam:TCRP1 1 194 1e-108 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140534
Predicted Effect probably damaging
Transcript: ENSMUST00000167518
AA Change: G21V

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000131720
Gene: ENSMUSG00000037503
AA Change: G21V

DomainStartEndE-ValueType
Pfam:TCRP1 1 62 3.3e-26 PFAM
Pfam:TCRP1 54 206 1.1e-89 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000170092
AA Change: G21V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000128676
Gene: ENSMUSG00000037503
AA Change: G21V

DomainStartEndE-ValueType
Pfam:TCRP1 1 201 8.8e-108 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000185231
AA Change: G21V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139456
Gene: ENSMUSG00000037503
AA Change: G21V

DomainStartEndE-ValueType
Pfam:TCRP1 1 90 7.5e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185279
Predicted Effect probably damaging
Transcript: ENSMUST00000185469
AA Change: G21V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141150
Gene: ENSMUSG00000037503
AA Change: G21V

DomainStartEndE-ValueType
Pfam:TCRP1 1 66 3.6e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000191307
AA Change: G21V

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000140573
Gene: ENSMUSG00000037503
AA Change: G21V

DomainStartEndE-ValueType
Pfam:TCRP1 1 206 2.8e-108 PFAM
Meta Mutation Damage Score 0.3811 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 100% (38/38)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahcyl1 C T 3: 107,675,085 G54D probably damaging Het
Aldh1b1 T C 4: 45,803,427 C322R probably damaging Het
Cdc14b T C 13: 64,215,563 I258V probably damaging Het
Cenph T C 13: 100,772,735 I55V probably benign Het
Cep290 T A 10: 100,569,144 probably null Het
Ces2b A G 8: 104,837,287 Y431C probably damaging Het
Cyp4f17 T C 17: 32,506,976 S28P possibly damaging Het
Cyp4f40 C G 17: 32,675,742 T427S possibly damaging Het
Exoc2 A G 13: 30,935,507 I137T probably benign Het
G3bp1 T A 11: 55,493,509 D168E probably benign Het
Gm765 T G 6: 98,248,208 H38P possibly damaging Het
Impg2 T A 16: 56,252,333 L376H probably damaging Het
Kdm4d A T 9: 14,463,065 M499K probably benign Het
Lonp1 C T 17: 56,619,230 V426M probably damaging Het
Lypla2 C A 4: 135,970,862 A26S probably benign Het
Map3k13 T C 16: 21,905,237 V323A possibly damaging Het
Mov10 A G 3: 104,818,044 L83P probably damaging Het
Mphosph9 G T 5: 124,260,116 A1039D probably damaging Het
Nedd1 T C 10: 92,698,337 K317R possibly damaging Het
Olfr1117-ps1 A G 2: 87,308,992 T68A possibly damaging Het
Pde3a T A 6: 141,479,346 S623T probably damaging Het
Pld1 T A 3: 28,041,199 M227K probably benign Het
Rell1 T G 5: 63,937,867 K85N probably damaging Het
Rhbdf1 T C 11: 32,215,652 T93A probably damaging Het
Sccpdh T A 1: 179,684,227 M88K possibly damaging Het
Siae T G 9: 37,642,799 probably null Het
Slc22a16 G A 10: 40,603,905 E637K unknown Het
Stk19 C T 17: 34,824,794 G95S probably benign Het
Stpg2 G A 3: 139,522,977 probably null Het
Sult2a5 T A 7: 13,624,132 F30I probably damaging Het
Svil A G 18: 5,082,853 E748G probably damaging Het
Swap70 T A 7: 110,269,919 H306Q probably benign Het
Try10 G A 6: 41,357,821 G227D probably damaging Het
Ttn T C 2: 76,896,369 probably benign Het
Ttn T A 2: 76,919,092 H3871L probably benign Het
Vmn1r231 T C 17: 20,890,483 I57V possibly damaging Het
Vpreb1 A G 16: 16,868,802 S75P probably damaging Het
Zkscan5 A G 5: 145,221,084 probably null Het
Other mutations in Fam168b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Fam168b APN 1 34836802 start codon destroyed probably null 0.58
R0207:Fam168b UTSW 1 34819688 missense probably damaging 0.98
R2008:Fam168b UTSW 1 34819865 critical splice donor site probably null
R4020:Fam168b UTSW 1 34828779 missense possibly damaging 0.71
R4617:Fam168b UTSW 1 34819982 missense possibly damaging 0.90
R5154:Fam168b UTSW 1 34818099 missense possibly damaging 0.83
R6167:Fam168b UTSW 1 34819603 missense probably damaging 1.00
R6600:Fam168b UTSW 1 34836741 missense probably damaging 1.00
R6602:Fam168b UTSW 1 34836741 missense probably damaging 1.00
R6603:Fam168b UTSW 1 34836741 missense probably damaging 1.00
R6627:Fam168b UTSW 1 34836741 missense probably damaging 1.00
R6628:Fam168b UTSW 1 34836741 missense probably damaging 1.00
R6644:Fam168b UTSW 1 34836741 missense probably damaging 1.00
R6705:Fam168b UTSW 1 34828783 missense probably damaging 0.98
R6985:Fam168b UTSW 1 34819708 missense probably damaging 1.00
R7387:Fam168b UTSW 1 34819708 missense probably damaging 1.00
Z1177:Fam168b UTSW 1 34819882 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GAGTCAGTTTGCCCACTGTC -3'
(R):5'- GGAGCAGCAGAAAATACTTTGC -3'

Sequencing Primer
(F):5'- GGTAAAACACTGTTGCCTGC -3'
(R):5'- GCAGCAGAAAATACTTTGCTTTATAG -3'
Posted On2018-07-23