Incidental Mutation 'R6692:Fam168b'
ID 527897
Institutional Source Beutler Lab
Gene Symbol Fam168b
Ensembl Gene ENSMUSG00000037503
Gene Name family with sequence similarity 168, member B
Synonyms
MMRRC Submission 044810-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.094) question?
Stock # R6692 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 34852307-34882094 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 34875822 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Valine at position 21 (G21V)
Ref Sequence ENSEMBL: ENSMUSP00000139456 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047534] [ENSMUST00000167518] [ENSMUST00000170092] [ENSMUST00000185231] [ENSMUST00000185469] [ENSMUST00000191307]
AlphaFold Q80XQ8
Predicted Effect possibly damaging
Transcript: ENSMUST00000047534
AA Change: G21V

PolyPhen 2 Score 0.807 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000042212
Gene: ENSMUSG00000037503
AA Change: G21V

DomainStartEndE-ValueType
Pfam:TCRP1 1 194 1e-108 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140534
Predicted Effect probably damaging
Transcript: ENSMUST00000167518
AA Change: G21V

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000131720
Gene: ENSMUSG00000037503
AA Change: G21V

DomainStartEndE-ValueType
Pfam:TCRP1 1 62 3.3e-26 PFAM
Pfam:TCRP1 54 206 1.1e-89 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000170092
AA Change: G21V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000128676
Gene: ENSMUSG00000037503
AA Change: G21V

DomainStartEndE-ValueType
Pfam:TCRP1 1 201 8.8e-108 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000185231
AA Change: G21V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139456
Gene: ENSMUSG00000037503
AA Change: G21V

DomainStartEndE-ValueType
Pfam:TCRP1 1 90 7.5e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185279
Predicted Effect probably damaging
Transcript: ENSMUST00000185469
AA Change: G21V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141150
Gene: ENSMUSG00000037503
AA Change: G21V

DomainStartEndE-ValueType
Pfam:TCRP1 1 66 3.6e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000191307
AA Change: G21V

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000140573
Gene: ENSMUSG00000037503
AA Change: G21V

DomainStartEndE-ValueType
Pfam:TCRP1 1 206 2.8e-108 PFAM
Meta Mutation Damage Score 0.3811 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 100% (38/38)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahcyl1 C T 3: 107,582,401 (GRCm39) G54D probably damaging Het
Aldh1b1 T C 4: 45,803,427 (GRCm39) C322R probably damaging Het
Cdc14b T C 13: 64,363,377 (GRCm39) I258V probably damaging Het
Cenph T C 13: 100,909,243 (GRCm39) I55V probably benign Het
Cep290 T A 10: 100,405,006 (GRCm39) probably null Het
Ces2b A G 8: 105,563,919 (GRCm39) Y431C probably damaging Het
Cyp4f17 T C 17: 32,725,950 (GRCm39) S28P possibly damaging Het
Cyp4f40 C G 17: 32,894,716 (GRCm39) T427S possibly damaging Het
Exoc2 A G 13: 31,119,490 (GRCm39) I137T probably benign Het
G3bp1 T A 11: 55,384,335 (GRCm39) D168E probably benign Het
Impg2 T A 16: 56,072,696 (GRCm39) L376H probably damaging Het
Kdm4d A T 9: 14,374,361 (GRCm39) M499K probably benign Het
Lonp1 C T 17: 56,926,230 (GRCm39) V426M probably damaging Het
Lypla2 C A 4: 135,698,173 (GRCm39) A26S probably benign Het
Map3k13 T C 16: 21,723,987 (GRCm39) V323A possibly damaging Het
Mdfic2 T G 6: 98,225,169 (GRCm39) H38P possibly damaging Het
Mov10 A G 3: 104,725,360 (GRCm39) L83P probably damaging Het
Mphosph9 G T 5: 124,398,179 (GRCm39) A1039D probably damaging Het
Nedd1 T C 10: 92,534,199 (GRCm39) K317R possibly damaging Het
Or10ag55-ps1 A G 2: 87,139,336 (GRCm39) T68A possibly damaging Het
Pde3a T A 6: 141,425,072 (GRCm39) S623T probably damaging Het
Pld1 T A 3: 28,095,348 (GRCm39) M227K probably benign Het
Rell1 T G 5: 64,095,210 (GRCm39) K85N probably damaging Het
Rhbdf1 T C 11: 32,165,652 (GRCm39) T93A probably damaging Het
Sccpdh T A 1: 179,511,792 (GRCm39) M88K possibly damaging Het
Siae T G 9: 37,554,095 (GRCm39) probably null Het
Slc22a16 G A 10: 40,479,901 (GRCm39) E637K unknown Het
Stk19 C T 17: 35,043,770 (GRCm39) G95S probably benign Het
Stpg2 G A 3: 139,228,738 (GRCm39) probably null Het
Sult2a5 T A 7: 13,358,057 (GRCm39) F30I probably damaging Het
Svil A G 18: 5,082,853 (GRCm39) E748G probably damaging Het
Swap70 T A 7: 109,869,126 (GRCm39) H306Q probably benign Het
Try10 G A 6: 41,334,755 (GRCm39) G227D probably damaging Het
Ttn T C 2: 76,726,713 (GRCm39) probably benign Het
Ttn T A 2: 76,749,436 (GRCm39) H3871L probably benign Het
Vmn1r231 T C 17: 21,110,745 (GRCm39) I57V possibly damaging Het
Vpreb1a A G 16: 16,686,666 (GRCm39) S75P probably damaging Het
Zkscan5 A G 5: 145,157,894 (GRCm39) probably null Het
Other mutations in Fam168b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Fam168b APN 1 34,875,883 (GRCm39) start codon destroyed probably null 0.58
R0207:Fam168b UTSW 1 34,858,769 (GRCm39) missense probably damaging 0.98
R2008:Fam168b UTSW 1 34,858,946 (GRCm39) critical splice donor site probably null
R4020:Fam168b UTSW 1 34,867,860 (GRCm39) missense possibly damaging 0.71
R4617:Fam168b UTSW 1 34,859,063 (GRCm39) missense possibly damaging 0.90
R5154:Fam168b UTSW 1 34,857,180 (GRCm39) missense possibly damaging 0.83
R6167:Fam168b UTSW 1 34,858,684 (GRCm39) missense probably damaging 1.00
R6600:Fam168b UTSW 1 34,875,822 (GRCm39) missense probably damaging 1.00
R6602:Fam168b UTSW 1 34,875,822 (GRCm39) missense probably damaging 1.00
R6603:Fam168b UTSW 1 34,875,822 (GRCm39) missense probably damaging 1.00
R6627:Fam168b UTSW 1 34,875,822 (GRCm39) missense probably damaging 1.00
R6628:Fam168b UTSW 1 34,875,822 (GRCm39) missense probably damaging 1.00
R6644:Fam168b UTSW 1 34,875,822 (GRCm39) missense probably damaging 1.00
R6705:Fam168b UTSW 1 34,867,864 (GRCm39) missense probably damaging 0.98
R6985:Fam168b UTSW 1 34,858,789 (GRCm39) missense probably damaging 1.00
R7387:Fam168b UTSW 1 34,858,789 (GRCm39) missense probably damaging 1.00
R8992:Fam168b UTSW 1 34,858,862 (GRCm39) missense probably benign 0.00
Z1177:Fam168b UTSW 1 34,858,963 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- GAGTCAGTTTGCCCACTGTC -3'
(R):5'- GGAGCAGCAGAAAATACTTTGC -3'

Sequencing Primer
(F):5'- GGTAAAACACTGTTGCCTGC -3'
(R):5'- GCAGCAGAAAATACTTTGCTTTATAG -3'
Posted On 2018-07-23