Incidental Mutation 'R6692:Sccpdh'
ID527898
Institutional Source Beutler Lab
Gene Symbol Sccpdh
Ensembl Gene ENSMUSG00000038936
Gene Namesaccharopine dehydrogenase (putative)
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.347) question?
Stock #R6692 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location179668210-179687189 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 179684227 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 88 (M88K)
Ref Sequence ENSEMBL: ENSMUSP00000115769 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040538] [ENSMUST00000134287] [ENSMUST00000143936]
Predicted Effect possibly damaging
Transcript: ENSMUST00000040538
AA Change: M338K

PolyPhen 2 Score 0.788 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000040956
Gene: ENSMUSG00000038936
AA Change: M338K

DomainStartEndE-ValueType
Pfam:Sacchrp_dh_NADP 10 149 2.4e-28 PFAM
transmembrane domain 277 299 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134287
SMART Domains Protein: ENSMUSP00000136880
Gene: ENSMUSG00000038936

DomainStartEndE-ValueType
Pfam:Saccharop_dh 10 130 9.2e-26 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000143936
AA Change: M88K

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000115769
Gene: ENSMUSG00000038936
AA Change: M88K

DomainStartEndE-ValueType
transmembrane domain 28 50 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000144480
AA Change: M78K
SMART Domains Protein: ENSMUSP00000121285
Gene: ENSMUSG00000038936
AA Change: M78K

DomainStartEndE-ValueType
Pfam:Sacchrp_dh_C 56 160 8.7e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192611
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 100% (38/38)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahcyl1 C T 3: 107,675,085 G54D probably damaging Het
Aldh1b1 T C 4: 45,803,427 C322R probably damaging Het
Cdc14b T C 13: 64,215,563 I258V probably damaging Het
Cenph T C 13: 100,772,735 I55V probably benign Het
Cep290 T A 10: 100,569,144 probably null Het
Ces2b A G 8: 104,837,287 Y431C probably damaging Het
Cyp4f17 T C 17: 32,506,976 S28P possibly damaging Het
Cyp4f40 C G 17: 32,675,742 T427S possibly damaging Het
Exoc2 A G 13: 30,935,507 I137T probably benign Het
Fam168b C A 1: 34,836,741 G21V probably damaging Het
G3bp1 T A 11: 55,493,509 D168E probably benign Het
Gm765 T G 6: 98,248,208 H38P possibly damaging Het
Impg2 T A 16: 56,252,333 L376H probably damaging Het
Kdm4d A T 9: 14,463,065 M499K probably benign Het
Lonp1 C T 17: 56,619,230 V426M probably damaging Het
Lypla2 C A 4: 135,970,862 A26S probably benign Het
Map3k13 T C 16: 21,905,237 V323A possibly damaging Het
Mov10 A G 3: 104,818,044 L83P probably damaging Het
Mphosph9 G T 5: 124,260,116 A1039D probably damaging Het
Nedd1 T C 10: 92,698,337 K317R possibly damaging Het
Olfr1117-ps1 A G 2: 87,308,992 T68A possibly damaging Het
Pde3a T A 6: 141,479,346 S623T probably damaging Het
Pld1 T A 3: 28,041,199 M227K probably benign Het
Rell1 T G 5: 63,937,867 K85N probably damaging Het
Rhbdf1 T C 11: 32,215,652 T93A probably damaging Het
Siae T G 9: 37,642,799 probably null Het
Slc22a16 G A 10: 40,603,905 E637K unknown Het
Stk19 C T 17: 34,824,794 G95S probably benign Het
Stpg2 G A 3: 139,522,977 probably null Het
Sult2a5 T A 7: 13,624,132 F30I probably damaging Het
Svil A G 18: 5,082,853 E748G probably damaging Het
Swap70 T A 7: 110,269,919 H306Q probably benign Het
Try10 G A 6: 41,357,821 G227D probably damaging Het
Ttn T C 2: 76,896,369 probably benign Het
Ttn T A 2: 76,919,092 H3871L probably benign Het
Vmn1r231 T C 17: 20,890,483 I57V possibly damaging Het
Vpreb1 A G 16: 16,868,802 S75P probably damaging Het
Zkscan5 A G 5: 145,221,084 probably null Het
Other mutations in Sccpdh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02026:Sccpdh APN 1 179678069 missense possibly damaging 0.90
IGL02225:Sccpdh APN 1 179679699 missense probably benign
IGL02428:Sccpdh APN 1 179680505 missense probably benign 0.01
IGL02516:Sccpdh APN 1 179681691 missense probably damaging 1.00
IGL02622:Sccpdh APN 1 179676460 missense probably damaging 1.00
IGL02708:Sccpdh APN 1 179680509 missense probably benign 0.32
IGL03209:Sccpdh APN 1 179686673 missense possibly damaging 0.89
R0508:Sccpdh UTSW 1 179680515 unclassified probably null
R1160:Sccpdh UTSW 1 179684210 missense probably benign 0.01
R1462:Sccpdh UTSW 1 179681560 splice site probably benign
R1965:Sccpdh UTSW 1 179684314 missense probably damaging 1.00
R2104:Sccpdh UTSW 1 179670597 missense probably benign
R2200:Sccpdh UTSW 1 179670606 missense possibly damaging 0.95
R4693:Sccpdh UTSW 1 179668410 missense possibly damaging 0.95
R5954:Sccpdh UTSW 1 179680588 missense probably benign 0.08
R6248:Sccpdh UTSW 1 179668392 missense probably benign 0.00
R6355:Sccpdh UTSW 1 179670600 missense probably benign 0.01
R6447:Sccpdh UTSW 1 179678888 makesense probably null
R8117:Sccpdh UTSW 1 179676452 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAACTTGAGTGAAAATCTGTCAC -3'
(R):5'- TTGGACCACAGATTTGACTCAG -3'

Sequencing Primer
(F):5'- GTGAAAATCTGTCACAGAATTCTGAG -3'
(R):5'- TTGCCATTCTCAAACTTTATTCAAC -3'
Posted On2018-07-23