Incidental Mutation 'R6692:Rell1'
ID527908
Institutional Source Beutler Lab
Gene Symbol Rell1
Ensembl Gene ENSMUSG00000047881
Gene NameRELT-like 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.105) question?
Stock #R6692 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location63908897-63968897 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 63937867 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 85 (K85N)
Ref Sequence ENSEMBL: ENSMUSP00000118125 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087327] [ENSMUST00000154169]
Predicted Effect probably benign
Transcript: ENSMUST00000087327
SMART Domains Protein: ENSMUSP00000084585
Gene: ENSMUSG00000047881

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000154169
AA Change: K85N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118125
Gene: ENSMUSG00000047881
AA Change: K85N

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:RELT 59 103 1.2e-26 PFAM
low complexity region 149 168 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 100% (38/38)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahcyl1 C T 3: 107,675,085 G54D probably damaging Het
Aldh1b1 T C 4: 45,803,427 C322R probably damaging Het
Cdc14b T C 13: 64,215,563 I258V probably damaging Het
Cenph T C 13: 100,772,735 I55V probably benign Het
Cep290 T A 10: 100,569,144 probably null Het
Ces2b A G 8: 104,837,287 Y431C probably damaging Het
Cyp4f17 T C 17: 32,506,976 S28P possibly damaging Het
Cyp4f40 C G 17: 32,675,742 T427S possibly damaging Het
Exoc2 A G 13: 30,935,507 I137T probably benign Het
Fam168b C A 1: 34,836,741 G21V probably damaging Het
G3bp1 T A 11: 55,493,509 D168E probably benign Het
Gm765 T G 6: 98,248,208 H38P possibly damaging Het
Impg2 T A 16: 56,252,333 L376H probably damaging Het
Kdm4d A T 9: 14,463,065 M499K probably benign Het
Lonp1 C T 17: 56,619,230 V426M probably damaging Het
Lypla2 C A 4: 135,970,862 A26S probably benign Het
Map3k13 T C 16: 21,905,237 V323A possibly damaging Het
Mov10 A G 3: 104,818,044 L83P probably damaging Het
Mphosph9 G T 5: 124,260,116 A1039D probably damaging Het
Nedd1 T C 10: 92,698,337 K317R possibly damaging Het
Olfr1117-ps1 A G 2: 87,308,992 T68A possibly damaging Het
Pde3a T A 6: 141,479,346 S623T probably damaging Het
Pld1 T A 3: 28,041,199 M227K probably benign Het
Rhbdf1 T C 11: 32,215,652 T93A probably damaging Het
Sccpdh T A 1: 179,684,227 M88K possibly damaging Het
Siae T G 9: 37,642,799 probably null Het
Slc22a16 G A 10: 40,603,905 E637K unknown Het
Stk19 C T 17: 34,824,794 G95S probably benign Het
Stpg2 G A 3: 139,522,977 probably null Het
Sult2a5 T A 7: 13,624,132 F30I probably damaging Het
Svil A G 18: 5,082,853 E748G probably damaging Het
Swap70 T A 7: 110,269,919 H306Q probably benign Het
Try10 G A 6: 41,357,821 G227D probably damaging Het
Ttn T C 2: 76,896,369 probably benign Het
Ttn T A 2: 76,919,092 H3871L probably benign Het
Vmn1r231 T C 17: 20,890,483 I57V possibly damaging Het
Vpreb1 A G 16: 16,868,802 S75P probably damaging Het
Zkscan5 A G 5: 145,221,084 probably null Het
Other mutations in Rell1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00806:Rell1 APN 5 63937814 missense probably damaging 1.00
IGL02374:Rell1 APN 5 63937808 missense possibly damaging 0.94
IGL02697:Rell1 APN 5 63927011 missense probably damaging 0.96
R0648:Rell1 UTSW 5 63924745 missense probably benign 0.05
R1471:Rell1 UTSW 5 63936085 missense probably damaging 1.00
R3177:Rell1 UTSW 5 63926987 critical splice donor site probably null
R3277:Rell1 UTSW 5 63926987 critical splice donor site probably null
R4095:Rell1 UTSW 5 63968670 missense probably benign
R4921:Rell1 UTSW 5 63936033 missense probably damaging 1.00
R4952:Rell1 UTSW 5 63939667 intron probably benign
R6294:Rell1 UTSW 5 63939705 intron probably benign
R7297:Rell1 UTSW 5 63936075 missense possibly damaging 0.86
X0028:Rell1 UTSW 5 63936095 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- AATGCAGGCAAGGTTTCAAAC -3'
(R):5'- ACCTAACAGAGCCGTGTGTG -3'

Sequencing Primer
(F):5'- GGCAAGGTTTCAAACTCTGATTACTG -3'
(R):5'- GTCCCTCTCTGTAGACAACACTGG -3'
Posted On2018-07-23