Incidental Mutation 'R6692:Zkscan5'
ID527910
Institutional Source Beutler Lab
Gene Symbol Zkscan5
Ensembl Gene ENSMUSG00000055991
Gene Namezinc finger with KRAB and SCAN domains 5
SynonymsZfp95, hKraba1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock #R6692 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location145204562-145221750 bp(+) (GRCm38)
Type of Mutationunclassified (2604 bp from exon)
DNA Base Change (assembly) A to G at 145221084 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000031601] [ENSMUST00000085671] [ENSMUST00000161896]
Predicted Effect probably benign
Transcript: ENSMUST00000031601
AA Change: M726V

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000031601
Gene: ENSMUSG00000055991
AA Change: M726V

DomainStartEndE-ValueType
SCAN 46 155 2.18e-69 SMART
ZnF_C2H2 268 290 3.58e-2 SMART
ZnF_C2H2 296 318 9.73e-4 SMART
ZnF_C2H2 324 346 1.45e-2 SMART
ZnF_C2H2 352 374 1.28e-3 SMART
ZnF_C2H2 467 489 1.82e-3 SMART
ZnF_C2H2 495 517 3.63e-3 SMART
ZnF_C2H2 523 545 7.78e-3 SMART
ZnF_C2H2 551 573 9.73e-4 SMART
ZnF_C2H2 579 601 1.08e-1 SMART
ZnF_C2H2 635 657 1.12e-3 SMART
ZnF_C2H2 691 713 5.14e-3 SMART
ZnF_C2H2 719 741 2.4e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000085671
AA Change: M799V

PolyPhen 2 Score 0.190 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000082814
Gene: ENSMUSG00000055991
AA Change: M799V

DomainStartEndE-ValueType
SCAN 46 155 2.18e-69 SMART
KRAB 216 276 5.35e-3 SMART
ZnF_C2H2 341 363 3.58e-2 SMART
ZnF_C2H2 369 391 9.73e-4 SMART
ZnF_C2H2 397 419 1.45e-2 SMART
ZnF_C2H2 425 447 1.28e-3 SMART
ZnF_C2H2 540 562 1.82e-3 SMART
ZnF_C2H2 568 590 3.63e-3 SMART
ZnF_C2H2 596 618 7.78e-3 SMART
ZnF_C2H2 624 646 9.73e-4 SMART
ZnF_C2H2 652 674 1.08e-1 SMART
ZnF_C2H2 708 730 1.12e-3 SMART
ZnF_C2H2 764 786 5.14e-3 SMART
ZnF_C2H2 792 814 2.4e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160162
Predicted Effect probably null
Transcript: ENSMUST00000161881
SMART Domains Protein: ENSMUSP00000124544
Gene: ENSMUSG00000055991

DomainStartEndE-ValueType
KRAB 59 118 2.71e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161896
SMART Domains Protein: ENSMUSP00000124838
Gene: ENSMUSG00000055991

DomainStartEndE-ValueType
SCAN 46 155 1.59e-62 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162168
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a zinc finger protein of the Kruppel family. The protein contains a SCAN box and a KRAB A domain and may be involved in transcriptional regulation. A similar protein in mouse is differentially expressed in spermatogenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahcyl1 C T 3: 107,675,085 G54D probably damaging Het
Aldh1b1 T C 4: 45,803,427 C322R probably damaging Het
Cdc14b T C 13: 64,215,563 I258V probably damaging Het
Cenph T C 13: 100,772,735 I55V probably benign Het
Cep290 T A 10: 100,569,144 probably null Het
Ces2b A G 8: 104,837,287 Y431C probably damaging Het
Cyp4f17 T C 17: 32,506,976 S28P possibly damaging Het
Cyp4f40 C G 17: 32,675,742 T427S possibly damaging Het
Exoc2 A G 13: 30,935,507 I137T probably benign Het
Fam168b C A 1: 34,836,741 G21V probably damaging Het
G3bp1 T A 11: 55,493,509 D168E probably benign Het
Gm765 T G 6: 98,248,208 H38P possibly damaging Het
Impg2 T A 16: 56,252,333 L376H probably damaging Het
Kdm4d A T 9: 14,463,065 M499K probably benign Het
Lonp1 C T 17: 56,619,230 V426M probably damaging Het
Lypla2 C A 4: 135,970,862 A26S probably benign Het
Map3k13 T C 16: 21,905,237 V323A possibly damaging Het
Mov10 A G 3: 104,818,044 L83P probably damaging Het
Mphosph9 G T 5: 124,260,116 A1039D probably damaging Het
Nedd1 T C 10: 92,698,337 K317R possibly damaging Het
Olfr1117-ps1 A G 2: 87,308,992 T68A possibly damaging Het
Pde3a T A 6: 141,479,346 S623T probably damaging Het
Pld1 T A 3: 28,041,199 M227K probably benign Het
Rell1 T G 5: 63,937,867 K85N probably damaging Het
Rhbdf1 T C 11: 32,215,652 T93A probably damaging Het
Sccpdh T A 1: 179,684,227 M88K possibly damaging Het
Siae T G 9: 37,642,799 probably null Het
Slc22a16 G A 10: 40,603,905 E637K unknown Het
Stk19 C T 17: 34,824,794 G95S probably benign Het
Stpg2 G A 3: 139,522,977 probably null Het
Sult2a5 T A 7: 13,624,132 F30I probably damaging Het
Svil A G 18: 5,082,853 E748G probably damaging Het
Swap70 T A 7: 110,269,919 H306Q probably benign Het
Try10 G A 6: 41,357,821 G227D probably damaging Het
Ttn T C 2: 76,896,369 probably benign Het
Ttn T A 2: 76,919,092 H3871L probably benign Het
Vmn1r231 T C 17: 20,890,483 I57V possibly damaging Het
Vpreb1 A G 16: 16,868,802 S75P probably damaging Het
Other mutations in Zkscan5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03080:Zkscan5 APN 5 145218650 missense probably damaging 0.99
R0401:Zkscan5 UTSW 5 145212575 missense probably damaging 0.99
R0458:Zkscan5 UTSW 5 145205471 missense probably damaging 0.97
R1456:Zkscan5 UTSW 5 145220988 missense probably benign 0.03
R1801:Zkscan5 UTSW 5 145220205 missense probably damaging 1.00
R2269:Zkscan5 UTSW 5 145205467 missense probably damaging 1.00
R2426:Zkscan5 UTSW 5 145220940 missense probably benign
R3085:Zkscan5 UTSW 5 145221079 missense probably damaging 1.00
R3153:Zkscan5 UTSW 5 145212627 missense probably benign
R3725:Zkscan5 UTSW 5 145220913 missense probably damaging 0.98
R4479:Zkscan5 UTSW 5 145211174 intron probably benign
R4647:Zkscan5 UTSW 5 145218830 missense possibly damaging 0.71
R5292:Zkscan5 UTSW 5 145218641 missense probably damaging 1.00
R5872:Zkscan5 UTSW 5 145220088 missense probably benign
R5873:Zkscan5 UTSW 5 145220394 missense possibly damaging 0.71
R5916:Zkscan5 UTSW 5 145205302 missense possibly damaging 0.90
R7092:Zkscan5 UTSW 5 145220089 missense probably benign
R7114:Zkscan5 UTSW 5 145211178 intron probably benign
R7403:Zkscan5 UTSW 5 145218593 missense probably benign 0.31
R7719:Zkscan5 UTSW 5 145220866 missense probably damaging 1.00
R7741:Zkscan5 UTSW 5 145221037 missense possibly damaging 0.51
R7751:Zkscan5 UTSW 5 145220866 missense probably damaging 1.00
R7829:Zkscan5 UTSW 5 145218703 nonsense probably null
R7874:Zkscan5 UTSW 5 145220866 missense probably damaging 1.00
R7875:Zkscan5 UTSW 5 145220866 missense probably damaging 1.00
R7876:Zkscan5 UTSW 5 145220866 missense probably damaging 1.00
R7879:Zkscan5 UTSW 5 145220866 missense probably damaging 1.00
R7884:Zkscan5 UTSW 5 145220866 missense probably damaging 1.00
R7899:Zkscan5 UTSW 5 145220866 missense probably damaging 1.00
R7902:Zkscan5 UTSW 5 145220866 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAACTCACTCTGCGGAGAAAC -3'
(R):5'- TAAGCTCTACCTGACAGGGC -3'

Sequencing Primer
(F):5'- CTGCGGAGAAACCCCAG -3'
(R):5'- TACCTGACAGGGCTTCCC -3'
Posted On2018-07-23