Incidental Mutation 'R6692:Try10'
ID527911
Institutional Source Beutler Lab
Gene Symbol Try10
Ensembl Gene ENSMUSG00000071521
Gene Nametrypsin 10
Synonymstrypsinogen 10
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R6692 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location41354105-41357914 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 41357821 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 227 (G227D)
Ref Sequence ENSEMBL: ENSMUSP00000071976 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072103]
Predicted Effect probably damaging
Transcript: ENSMUST00000072103
AA Change: G227D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000071976
Gene: ENSMUSG00000071521
AA Change: G227D

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
Tryp_SPc 23 239 3.38e-104 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a trypsinogen, which is a member of the trypsin family of serine proteases. This enzyme is secreted by the pancreas and cleaved to its active form in the small intestine. It is active on peptide linkages involving the carboxyl group of lysine or arginine. Mutations in this gene are associated with hereditary pancreatitis. This gene and several other trypsinogen genes are localized to the T cell receptor beta locus on chromosome 7. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahcyl1 C T 3: 107,675,085 G54D probably damaging Het
Aldh1b1 T C 4: 45,803,427 C322R probably damaging Het
Cdc14b T C 13: 64,215,563 I258V probably damaging Het
Cenph T C 13: 100,772,735 I55V probably benign Het
Cep290 T A 10: 100,569,144 probably null Het
Ces2b A G 8: 104,837,287 Y431C probably damaging Het
Cyp4f17 T C 17: 32,506,976 S28P possibly damaging Het
Cyp4f40 C G 17: 32,675,742 T427S possibly damaging Het
Exoc2 A G 13: 30,935,507 I137T probably benign Het
Fam168b C A 1: 34,836,741 G21V probably damaging Het
G3bp1 T A 11: 55,493,509 D168E probably benign Het
Gm765 T G 6: 98,248,208 H38P possibly damaging Het
Impg2 T A 16: 56,252,333 L376H probably damaging Het
Kdm4d A T 9: 14,463,065 M499K probably benign Het
Lonp1 C T 17: 56,619,230 V426M probably damaging Het
Lypla2 C A 4: 135,970,862 A26S probably benign Het
Map3k13 T C 16: 21,905,237 V323A possibly damaging Het
Mov10 A G 3: 104,818,044 L83P probably damaging Het
Mphosph9 G T 5: 124,260,116 A1039D probably damaging Het
Nedd1 T C 10: 92,698,337 K317R possibly damaging Het
Olfr1117-ps1 A G 2: 87,308,992 T68A possibly damaging Het
Pde3a T A 6: 141,479,346 S623T probably damaging Het
Pld1 T A 3: 28,041,199 M227K probably benign Het
Rell1 T G 5: 63,937,867 K85N probably damaging Het
Rhbdf1 T C 11: 32,215,652 T93A probably damaging Het
Sccpdh T A 1: 179,684,227 M88K possibly damaging Het
Siae T G 9: 37,642,799 probably null Het
Slc22a16 G A 10: 40,603,905 E637K unknown Het
Stk19 C T 17: 34,824,794 G95S probably benign Het
Stpg2 G A 3: 139,522,977 probably null Het
Sult2a5 T A 7: 13,624,132 F30I probably damaging Het
Svil A G 18: 5,082,853 E748G probably damaging Het
Swap70 T A 7: 110,269,919 H306Q probably benign Het
Ttn T C 2: 76,896,369 probably benign Het
Ttn T A 2: 76,919,092 H3871L probably benign Het
Vmn1r231 T C 17: 20,890,483 I57V possibly damaging Het
Vpreb1 A G 16: 16,868,802 S75P probably damaging Het
Zkscan5 A G 5: 145,221,084 probably null Het
Other mutations in Try10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02001:Try10 APN 6 41356589 missense probably benign 0.00
IGL02608:Try10 APN 6 41355487 missense probably damaging 1.00
IGL03280:Try10 APN 6 41354220 missense probably benign 0.18
R0332:Try10 UTSW 6 41354220 missense probably benign 0.18
R1628:Try10 UTSW 6 41357456 missense probably damaging 1.00
R2149:Try10 UTSW 6 41356561 missense probably benign 0.02
R2471:Try10 UTSW 6 41356746 missense probably damaging 1.00
R3764:Try10 UTSW 6 41356524 missense probably benign 0.07
R4008:Try10 UTSW 6 41356674 missense probably benign 0.00
R4660:Try10 UTSW 6 41357827 missense probably damaging 1.00
R4792:Try10 UTSW 6 41355452 missense probably benign 0.33
R5185:Try10 UTSW 6 41356549 missense probably damaging 0.96
R6103:Try10 UTSW 6 41356550 missense probably damaging 0.98
R6301:Try10 UTSW 6 41355589 missense probably benign 0.30
R7786:Try10 UTSW 6 41355529 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- TGGCTAGAATGGCATCTTCAGG -3'
(R):5'- CAACATATATGGAGCTGTAGGATGC -3'

Sequencing Primer
(F):5'- CTTCAGGTCAGAGTAATGTGATCC -3'
(R):5'- AGCTGTAGGATGCTTGTCACATATC -3'
Posted On2018-07-23