Incidental Mutation 'R6692:Pde3a'
ID 527913
Institutional Source Beutler Lab
Gene Symbol Pde3a
Ensembl Gene ENSMUSG00000041741
Gene Name phosphodiesterase 3A, cGMP inhibited
Synonyms A930022O17Rik
MMRRC Submission 044810-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.271) question?
Stock # R6692 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 141194995-141452588 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 141425072 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 623 (S623T)
Ref Sequence ENSEMBL: ENSMUSP00000038749 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043259]
AlphaFold Q9Z0X4
Predicted Effect probably damaging
Transcript: ENSMUST00000043259
AA Change: S623T

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000038749
Gene: ENSMUSG00000041741
AA Change: S623T

DomainStartEndE-ValueType
low complexity region 29 43 N/A INTRINSIC
transmembrane domain 60 82 N/A INTRINSIC
low complexity region 93 102 N/A INTRINSIC
low complexity region 103 121 N/A INTRINSIC
transmembrane domain 126 148 N/A INTRINSIC
transmembrane domain 155 177 N/A INTRINSIC
transmembrane domain 187 209 N/A INTRINSIC
transmembrane domain 230 252 N/A INTRINSIC
low complexity region 419 445 N/A INTRINSIC
low complexity region 520 544 N/A INTRINSIC
HDc 749 964 3.76e-4 SMART
low complexity region 1028 1056 N/A INTRINSIC
low complexity region 1114 1133 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cGMP-inhibited cyclic nucleotide phosphodiesterase (cGI-PDE) family. cGI-PDE enzymes hydrolyze both cAMP and cGMP, and play critical roles in many cellular processes by regulating the amplitude and duration of intracellular cyclic nucleotide signals. The encoded protein mediates platelet aggregation and also plays important roles in cardiovascular function by regulating vascular smooth muscle contraction and relaxation. Inhibitors of the encoded protein may be effective in treating congestive heart failure. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygous null mice display female infertility with oocyte arrest. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahcyl1 C T 3: 107,582,401 (GRCm39) G54D probably damaging Het
Aldh1b1 T C 4: 45,803,427 (GRCm39) C322R probably damaging Het
Cdc14b T C 13: 64,363,377 (GRCm39) I258V probably damaging Het
Cenph T C 13: 100,909,243 (GRCm39) I55V probably benign Het
Cep290 T A 10: 100,405,006 (GRCm39) probably null Het
Ces2b A G 8: 105,563,919 (GRCm39) Y431C probably damaging Het
Cyp4f17 T C 17: 32,725,950 (GRCm39) S28P possibly damaging Het
Cyp4f40 C G 17: 32,894,716 (GRCm39) T427S possibly damaging Het
Exoc2 A G 13: 31,119,490 (GRCm39) I137T probably benign Het
Fam168b C A 1: 34,875,822 (GRCm39) G21V probably damaging Het
G3bp1 T A 11: 55,384,335 (GRCm39) D168E probably benign Het
Impg2 T A 16: 56,072,696 (GRCm39) L376H probably damaging Het
Kdm4d A T 9: 14,374,361 (GRCm39) M499K probably benign Het
Lonp1 C T 17: 56,926,230 (GRCm39) V426M probably damaging Het
Lypla2 C A 4: 135,698,173 (GRCm39) A26S probably benign Het
Map3k13 T C 16: 21,723,987 (GRCm39) V323A possibly damaging Het
Mdfic2 T G 6: 98,225,169 (GRCm39) H38P possibly damaging Het
Mov10 A G 3: 104,725,360 (GRCm39) L83P probably damaging Het
Mphosph9 G T 5: 124,398,179 (GRCm39) A1039D probably damaging Het
Nedd1 T C 10: 92,534,199 (GRCm39) K317R possibly damaging Het
Or10ag55-ps1 A G 2: 87,139,336 (GRCm39) T68A possibly damaging Het
Pld1 T A 3: 28,095,348 (GRCm39) M227K probably benign Het
Rell1 T G 5: 64,095,210 (GRCm39) K85N probably damaging Het
Rhbdf1 T C 11: 32,165,652 (GRCm39) T93A probably damaging Het
Sccpdh T A 1: 179,511,792 (GRCm39) M88K possibly damaging Het
Siae T G 9: 37,554,095 (GRCm39) probably null Het
Slc22a16 G A 10: 40,479,901 (GRCm39) E637K unknown Het
Stk19 C T 17: 35,043,770 (GRCm39) G95S probably benign Het
Stpg2 G A 3: 139,228,738 (GRCm39) probably null Het
Sult2a5 T A 7: 13,358,057 (GRCm39) F30I probably damaging Het
Svil A G 18: 5,082,853 (GRCm39) E748G probably damaging Het
Swap70 T A 7: 109,869,126 (GRCm39) H306Q probably benign Het
Try10 G A 6: 41,334,755 (GRCm39) G227D probably damaging Het
Ttn T C 2: 76,726,713 (GRCm39) probably benign Het
Ttn T A 2: 76,749,436 (GRCm39) H3871L probably benign Het
Vmn1r231 T C 17: 21,110,745 (GRCm39) I57V possibly damaging Het
Vpreb1a A G 16: 16,686,666 (GRCm39) S75P probably damaging Het
Zkscan5 A G 5: 145,157,894 (GRCm39) probably null Het
Other mutations in Pde3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01388:Pde3a APN 6 141,405,464 (GRCm39) missense probably damaging 1.00
IGL01400:Pde3a APN 6 141,404,954 (GRCm39) missense probably benign 0.02
IGL01752:Pde3a APN 6 141,433,339 (GRCm39) splice site probably benign
IGL01819:Pde3a APN 6 141,433,263 (GRCm39) missense probably damaging 1.00
IGL02014:Pde3a APN 6 141,404,870 (GRCm39) missense probably null 1.00
IGL02119:Pde3a APN 6 141,405,529 (GRCm39) missense probably damaging 0.97
IGL02465:Pde3a APN 6 141,195,401 (GRCm39) missense possibly damaging 0.53
IGL02677:Pde3a APN 6 141,350,898 (GRCm39) splice site probably benign
IGL02961:Pde3a APN 6 141,405,426 (GRCm39) nonsense probably null
IGL03034:Pde3a APN 6 141,438,126 (GRCm39) splice site probably benign
IGL03142:Pde3a APN 6 141,438,025 (GRCm39) missense probably benign 0.01
PIT4305001:Pde3a UTSW 6 141,438,036 (GRCm39) missense probably benign 0.04
R0412:Pde3a UTSW 6 141,444,410 (GRCm39) missense probably damaging 1.00
R0517:Pde3a UTSW 6 141,444,383 (GRCm39) nonsense probably null
R0573:Pde3a UTSW 6 141,437,957 (GRCm39) missense probably damaging 1.00
R0621:Pde3a UTSW 6 141,195,725 (GRCm39) missense probably damaging 1.00
R0781:Pde3a UTSW 6 141,405,042 (GRCm39) splice site probably benign
R1065:Pde3a UTSW 6 141,422,458 (GRCm39) splice site probably benign
R1110:Pde3a UTSW 6 141,405,042 (GRCm39) splice site probably benign
R1462:Pde3a UTSW 6 141,405,560 (GRCm39) missense probably benign 0.05
R1462:Pde3a UTSW 6 141,405,560 (GRCm39) missense probably benign 0.05
R1470:Pde3a UTSW 6 141,411,932 (GRCm39) missense probably benign 0.41
R1470:Pde3a UTSW 6 141,411,932 (GRCm39) missense probably benign 0.41
R1480:Pde3a UTSW 6 141,433,300 (GRCm39) missense probably benign 0.17
R1559:Pde3a UTSW 6 141,404,824 (GRCm39) missense probably damaging 1.00
R1862:Pde3a UTSW 6 141,433,239 (GRCm39) missense probably damaging 1.00
R1862:Pde3a UTSW 6 141,196,079 (GRCm39) missense probably damaging 1.00
R1902:Pde3a UTSW 6 141,444,496 (GRCm39) missense probably benign
R1909:Pde3a UTSW 6 141,195,965 (GRCm39) missense probably benign 0.00
R2048:Pde3a UTSW 6 141,434,732 (GRCm39) splice site probably benign
R2144:Pde3a UTSW 6 141,435,837 (GRCm39) missense probably benign 0.40
R2155:Pde3a UTSW 6 141,429,640 (GRCm39) missense possibly damaging 0.70
R2208:Pde3a UTSW 6 141,196,073 (GRCm39) missense probably damaging 0.97
R2405:Pde3a UTSW 6 141,426,968 (GRCm39) missense probably damaging 1.00
R4592:Pde3a UTSW 6 141,404,942 (GRCm39) missense probably benign 0.13
R4677:Pde3a UTSW 6 141,411,865 (GRCm39) missense probably benign 0.02
R4803:Pde3a UTSW 6 141,404,812 (GRCm39) missense probably damaging 1.00
R4887:Pde3a UTSW 6 141,416,668 (GRCm39) missense possibly damaging 0.94
R4999:Pde3a UTSW 6 141,195,751 (GRCm39) missense probably benign 0.00
R5055:Pde3a UTSW 6 141,433,682 (GRCm39) nonsense probably null
R5181:Pde3a UTSW 6 141,426,981 (GRCm39) critical splice donor site probably null
R5640:Pde3a UTSW 6 141,429,641 (GRCm39) missense probably damaging 0.99
R5694:Pde3a UTSW 6 141,196,228 (GRCm39) missense possibly damaging 0.48
R6176:Pde3a UTSW 6 141,444,615 (GRCm39) missense possibly damaging 0.96
R6394:Pde3a UTSW 6 141,433,237 (GRCm39) missense probably damaging 1.00
R6968:Pde3a UTSW 6 141,433,658 (GRCm39) missense probably damaging 1.00
R7137:Pde3a UTSW 6 141,444,472 (GRCm39) missense probably benign 0.26
R7163:Pde3a UTSW 6 141,433,270 (GRCm39) missense probably damaging 1.00
R7677:Pde3a UTSW 6 141,195,983 (GRCm39) missense probably damaging 1.00
R7754:Pde3a UTSW 6 141,404,975 (GRCm39) missense probably benign 0.32
R8037:Pde3a UTSW 6 141,429,650 (GRCm39) missense possibly damaging 0.82
R8123:Pde3a UTSW 6 141,411,917 (GRCm39) missense probably benign 0.00
R8206:Pde3a UTSW 6 141,433,611 (GRCm39) missense probably damaging 1.00
R8262:Pde3a UTSW 6 141,433,527 (GRCm39) missense possibly damaging 0.89
R8376:Pde3a UTSW 6 141,426,947 (GRCm39) missense possibly damaging 0.50
R8893:Pde3a UTSW 6 141,405,522 (GRCm39) missense probably damaging 1.00
R9037:Pde3a UTSW 6 141,416,832 (GRCm39) missense probably damaging 1.00
R9158:Pde3a UTSW 6 141,195,614 (GRCm39) missense probably benign
R9222:Pde3a UTSW 6 141,437,904 (GRCm39) missense probably damaging 1.00
R9318:Pde3a UTSW 6 141,425,202 (GRCm39) missense probably benign 0.01
R9385:Pde3a UTSW 6 141,437,982 (GRCm39) missense probably benign 0.30
X0053:Pde3a UTSW 6 141,429,695 (GRCm39) splice site probably null
X0062:Pde3a UTSW 6 141,195,710 (GRCm39) missense probably damaging 1.00
Z1177:Pde3a UTSW 6 141,196,195 (GRCm39) missense probably benign 0.39
Predicted Primers PCR Primer
(F):5'- TGAGAGCCACTGAATGTCAC -3'
(R):5'- GCAATGGAAGCAAGTTCTCATG -3'

Sequencing Primer
(F):5'- GAAAACTGGAGTTCTGTTCCCAGC -3'
(R):5'- TGGAAGCAAGTTCTCATGGAAATG -3'
Posted On 2018-07-23