Incidental Mutation 'R6692:Swap70'
ID527915
Institutional Source Beutler Lab
Gene Symbol Swap70
Ensembl Gene ENSMUSG00000031015
Gene NameSWA-70 protein
Synonyms70kDa
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.845) question?
Stock #R6692 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location110221711-110283506 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 110269919 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 306 (H306Q)
Ref Sequence ENSEMBL: ENSMUSP00000033325 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033325]
Predicted Effect probably benign
Transcript: ENSMUST00000033325
AA Change: H306Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000033325
Gene: ENSMUSG00000031015
AA Change: H306Q

DomainStartEndE-ValueType
PH 211 308 7.23e-20 SMART
coiled coil region 316 529 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210513
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210743
Meta Mutation Damage Score 0.0612 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 100% (38/38)
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene results in increased sensitivity of B lymphocytes to gamma-radiation, increased autoantibody levels, and lower IgE levels, both before and after immunization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahcyl1 C T 3: 107,675,085 G54D probably damaging Het
Aldh1b1 T C 4: 45,803,427 C322R probably damaging Het
Cdc14b T C 13: 64,215,563 I258V probably damaging Het
Cenph T C 13: 100,772,735 I55V probably benign Het
Cep290 T A 10: 100,569,144 probably null Het
Ces2b A G 8: 104,837,287 Y431C probably damaging Het
Cyp4f17 T C 17: 32,506,976 S28P possibly damaging Het
Cyp4f40 C G 17: 32,675,742 T427S possibly damaging Het
Exoc2 A G 13: 30,935,507 I137T probably benign Het
Fam168b C A 1: 34,836,741 G21V probably damaging Het
G3bp1 T A 11: 55,493,509 D168E probably benign Het
Gm765 T G 6: 98,248,208 H38P possibly damaging Het
Impg2 T A 16: 56,252,333 L376H probably damaging Het
Kdm4d A T 9: 14,463,065 M499K probably benign Het
Lonp1 C T 17: 56,619,230 V426M probably damaging Het
Lypla2 C A 4: 135,970,862 A26S probably benign Het
Map3k13 T C 16: 21,905,237 V323A possibly damaging Het
Mov10 A G 3: 104,818,044 L83P probably damaging Het
Mphosph9 G T 5: 124,260,116 A1039D probably damaging Het
Nedd1 T C 10: 92,698,337 K317R possibly damaging Het
Olfr1117-ps1 A G 2: 87,308,992 T68A possibly damaging Het
Pde3a T A 6: 141,479,346 S623T probably damaging Het
Pld1 T A 3: 28,041,199 M227K probably benign Het
Rell1 T G 5: 63,937,867 K85N probably damaging Het
Rhbdf1 T C 11: 32,215,652 T93A probably damaging Het
Sccpdh T A 1: 179,684,227 M88K possibly damaging Het
Siae T G 9: 37,642,799 probably null Het
Slc22a16 G A 10: 40,603,905 E637K unknown Het
Stk19 C T 17: 34,824,794 G95S probably benign Het
Stpg2 G A 3: 139,522,977 probably null Het
Sult2a5 T A 7: 13,624,132 F30I probably damaging Het
Svil A G 18: 5,082,853 E748G probably damaging Het
Try10 G A 6: 41,357,821 G227D probably damaging Het
Ttn T C 2: 76,896,369 probably benign Het
Ttn T A 2: 76,919,092 H3871L probably benign Het
Vmn1r231 T C 17: 20,890,483 I57V possibly damaging Het
Vpreb1 A G 16: 16,868,802 S75P probably damaging Het
Zkscan5 A G 5: 145,221,084 probably null Het
Other mutations in Swap70
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01888:Swap70 APN 7 110280634 missense probably damaging 1.00
IGL02307:Swap70 APN 7 110281294 missense probably benign 0.05
IGL02429:Swap70 APN 7 110263972 missense probably benign
IGL02741:Swap70 APN 7 110274649 missense probably benign 0.01
galloping UTSW 7 110269919 missense probably benign
R0037:Swap70 UTSW 7 110264080 missense possibly damaging 0.77
R0041:Swap70 UTSW 7 110279355 missense probably benign 0.04
R0041:Swap70 UTSW 7 110279355 missense probably benign 0.04
R0116:Swap70 UTSW 7 110273282 missense probably benign 0.25
R1615:Swap70 UTSW 7 110273291 missense probably benign 0.01
R1623:Swap70 UTSW 7 110264048 missense probably benign 0.00
R1656:Swap70 UTSW 7 110221827 missense probably benign 0.02
R1932:Swap70 UTSW 7 110279263 missense possibly damaging 0.70
R3720:Swap70 UTSW 7 110270047 missense probably damaging 0.98
R3753:Swap70 UTSW 7 110267881 missense probably damaging 1.00
R4012:Swap70 UTSW 7 110281305 missense possibly damaging 0.92
R4623:Swap70 UTSW 7 110267872 missense probably benign 0.42
R6158:Swap70 UTSW 7 110270023 missense probably damaging 1.00
R6180:Swap70 UTSW 7 110269981 missense probably damaging 1.00
R6521:Swap70 UTSW 7 110255820 missense probably benign 0.00
R6823:Swap70 UTSW 7 110281303 missense possibly damaging 0.75
R6846:Swap70 UTSW 7 110255749 missense possibly damaging 0.94
R7417:Swap70 UTSW 7 110264109 critical splice donor site probably null
R7466:Swap70 UTSW 7 110274772 missense probably benign 0.19
R7893:Swap70 UTSW 7 110221875 missense probably benign 0.00
R7976:Swap70 UTSW 7 110221875 missense probably benign 0.00
R8132:Swap70 UTSW 7 110255877 missense probably damaging 0.99
Z1177:Swap70 UTSW 7 110273281 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- TGTGGACCTGGACTCAGAAAAG -3'
(R):5'- AAAGCTCCTGAGGCTGTGTG -3'

Sequencing Primer
(F):5'- AGACTTGAACGCACATCTTTCTCATG -3'
(R):5'- GACAGCGCTTCCCTTGC -3'
Posted On2018-07-23