Incidental Mutation 'R6692:Ces2b'
ID 527916
Institutional Source Beutler Lab
Gene Symbol Ces2b
Ensembl Gene ENSMUSG00000050097
Gene Name carboxyesterase 2B
Synonyms
MMRRC Submission 044810-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.050) question?
Stock # R6692 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 105558204-105566725 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 105563919 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 431 (Y431C)
Ref Sequence ENSEMBL: ENSMUSP00000063005 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059449] [ENSMUST00000163042]
AlphaFold Q6PDB7
Predicted Effect probably damaging
Transcript: ENSMUST00000059449
AA Change: Y431C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000063005
Gene: ENSMUSG00000050097
AA Change: Y431C

DomainStartEndE-ValueType
Pfam:COesterase 10 535 8.5e-175 PFAM
Pfam:Abhydrolase_3 140 305 1.8e-11 PFAM
Pfam:Peptidase_S9 161 296 9e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163042
SMART Domains Protein: ENSMUSP00000124796
Gene: ENSMUSG00000050097

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 100% (38/38)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahcyl1 C T 3: 107,582,401 (GRCm39) G54D probably damaging Het
Aldh1b1 T C 4: 45,803,427 (GRCm39) C322R probably damaging Het
Cdc14b T C 13: 64,363,377 (GRCm39) I258V probably damaging Het
Cenph T C 13: 100,909,243 (GRCm39) I55V probably benign Het
Cep290 T A 10: 100,405,006 (GRCm39) probably null Het
Cyp4f17 T C 17: 32,725,950 (GRCm39) S28P possibly damaging Het
Cyp4f40 C G 17: 32,894,716 (GRCm39) T427S possibly damaging Het
Exoc2 A G 13: 31,119,490 (GRCm39) I137T probably benign Het
Fam168b C A 1: 34,875,822 (GRCm39) G21V probably damaging Het
G3bp1 T A 11: 55,384,335 (GRCm39) D168E probably benign Het
Impg2 T A 16: 56,072,696 (GRCm39) L376H probably damaging Het
Kdm4d A T 9: 14,374,361 (GRCm39) M499K probably benign Het
Lonp1 C T 17: 56,926,230 (GRCm39) V426M probably damaging Het
Lypla2 C A 4: 135,698,173 (GRCm39) A26S probably benign Het
Map3k13 T C 16: 21,723,987 (GRCm39) V323A possibly damaging Het
Mdfic2 T G 6: 98,225,169 (GRCm39) H38P possibly damaging Het
Mov10 A G 3: 104,725,360 (GRCm39) L83P probably damaging Het
Mphosph9 G T 5: 124,398,179 (GRCm39) A1039D probably damaging Het
Nedd1 T C 10: 92,534,199 (GRCm39) K317R possibly damaging Het
Or10ag55-ps1 A G 2: 87,139,336 (GRCm39) T68A possibly damaging Het
Pde3a T A 6: 141,425,072 (GRCm39) S623T probably damaging Het
Pld1 T A 3: 28,095,348 (GRCm39) M227K probably benign Het
Rell1 T G 5: 64,095,210 (GRCm39) K85N probably damaging Het
Rhbdf1 T C 11: 32,165,652 (GRCm39) T93A probably damaging Het
Sccpdh T A 1: 179,511,792 (GRCm39) M88K possibly damaging Het
Siae T G 9: 37,554,095 (GRCm39) probably null Het
Slc22a16 G A 10: 40,479,901 (GRCm39) E637K unknown Het
Stk19 C T 17: 35,043,770 (GRCm39) G95S probably benign Het
Stpg2 G A 3: 139,228,738 (GRCm39) probably null Het
Sult2a5 T A 7: 13,358,057 (GRCm39) F30I probably damaging Het
Svil A G 18: 5,082,853 (GRCm39) E748G probably damaging Het
Swap70 T A 7: 109,869,126 (GRCm39) H306Q probably benign Het
Try10 G A 6: 41,334,755 (GRCm39) G227D probably damaging Het
Ttn T C 2: 76,726,713 (GRCm39) probably benign Het
Ttn T A 2: 76,749,436 (GRCm39) H3871L probably benign Het
Vmn1r231 T C 17: 21,110,745 (GRCm39) I57V possibly damaging Het
Vpreb1a A G 16: 16,686,666 (GRCm39) S75P probably damaging Het
Zkscan5 A G 5: 145,157,894 (GRCm39) probably null Het
Other mutations in Ces2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01388:Ces2b APN 8 105,561,236 (GRCm39) splice site probably benign
IGL01905:Ces2b APN 8 105,560,594 (GRCm39) missense probably damaging 1.00
IGL02528:Ces2b APN 8 105,561,601 (GRCm39) missense probably damaging 1.00
IGL02659:Ces2b APN 8 105,559,202 (GRCm39) splice site probably benign
IGL02885:Ces2b APN 8 105,561,563 (GRCm39) missense probably damaging 1.00
PIT4142001:Ces2b UTSW 8 105,563,442 (GRCm39) missense probably damaging 1.00
R0092:Ces2b UTSW 8 105,563,144 (GRCm39) missense possibly damaging 0.48
R0403:Ces2b UTSW 8 105,560,577 (GRCm39) missense probably damaging 0.98
R0600:Ces2b UTSW 8 105,562,542 (GRCm39) missense probably benign 0.06
R0637:Ces2b UTSW 8 105,561,237 (GRCm39) splice site probably benign
R1574:Ces2b UTSW 8 105,562,521 (GRCm39) missense probably benign 0.16
R1574:Ces2b UTSW 8 105,562,521 (GRCm39) missense probably benign 0.16
R3036:Ces2b UTSW 8 105,561,258 (GRCm39) missense possibly damaging 0.87
R3086:Ces2b UTSW 8 105,559,401 (GRCm39) missense possibly damaging 0.92
R4761:Ces2b UTSW 8 105,563,193 (GRCm39) critical splice donor site probably null
R4920:Ces2b UTSW 8 105,563,538 (GRCm39) missense probably benign
R4937:Ces2b UTSW 8 105,559,413 (GRCm39) missense probably benign 0.29
R5211:Ces2b UTSW 8 105,561,695 (GRCm39) missense possibly damaging 0.89
R5550:Ces2b UTSW 8 105,565,069 (GRCm39) missense probably benign 0.00
R5790:Ces2b UTSW 8 105,560,568 (GRCm39) missense probably damaging 1.00
R6403:Ces2b UTSW 8 105,562,901 (GRCm39) nonsense probably null
R6720:Ces2b UTSW 8 105,563,501 (GRCm39) missense probably benign 0.32
R6899:Ces2b UTSW 8 105,563,398 (GRCm39) splice site probably null
R7148:Ces2b UTSW 8 105,564,928 (GRCm39) missense probably damaging 1.00
R7270:Ces2b UTSW 8 105,564,472 (GRCm39) missense possibly damaging 0.50
R7571:Ces2b UTSW 8 105,561,641 (GRCm39) missense probably damaging 1.00
R7626:Ces2b UTSW 8 105,564,017 (GRCm39) missense possibly damaging 0.82
R7841:Ces2b UTSW 8 105,561,692 (GRCm39) missense probably benign 0.19
R7892:Ces2b UTSW 8 105,559,385 (GRCm39) missense probably damaging 1.00
R8029:Ces2b UTSW 8 105,561,482 (GRCm39) missense probably damaging 1.00
R8293:Ces2b UTSW 8 105,559,258 (GRCm39) missense unknown
R8296:Ces2b UTSW 8 105,563,112 (GRCm39) missense possibly damaging 0.77
R8721:Ces2b UTSW 8 105,560,527 (GRCm39) missense possibly damaging 0.88
R9100:Ces2b UTSW 8 105,558,221 (GRCm39) unclassified probably benign
R9361:Ces2b UTSW 8 105,564,039 (GRCm39) critical splice donor site probably null
R9461:Ces2b UTSW 8 105,564,011 (GRCm39) missense probably benign 0.39
R9477:Ces2b UTSW 8 105,560,556 (GRCm39) missense probably damaging 1.00
X0027:Ces2b UTSW 8 105,560,560 (GRCm39) missense probably damaging 1.00
Z1177:Ces2b UTSW 8 105,559,227 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- ATGGGCACTGATTAGCCAAG -3'
(R):5'- TAGGTTTCCTCAACGGCCTG -3'

Sequencing Primer
(F):5'- GCCAAGGGCTTTTTCACAG -3'
(R):5'- TTTCCTCAACGGCCTGAGAGC -3'
Posted On 2018-07-23