Incidental Mutation 'R6692:Kdm4d'
ID527917
Institutional Source Beutler Lab
Gene Symbol Kdm4d
Ensembl Gene ENSMUSG00000053914
Gene Namelysine (K)-specific demethylase 4D
SynonymsJmjd2d
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6692 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location14462548-14500482 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 14463065 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 499 (M499K)
Ref Sequence ENSEMBL: ENSMUSP00000061632 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058796] [ENSMUST00000115647]
Predicted Effect probably benign
Transcript: ENSMUST00000058796
AA Change: M499K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000061632
Gene: ENSMUSG00000053914
AA Change: M499K

DomainStartEndE-ValueType
Pfam:JmjN 16 50 3.3e-15 PFAM
JmjC 143 309 2.3e-57 SMART
low complexity region 370 383 N/A INTRINSIC
low complexity region 417 434 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115647
SMART Domains Protein: ENSMUSP00000111311
Gene: ENSMUSG00000053914

DomainStartEndE-ValueType
Pfam:JmjN 16 50 1.1e-16 PFAM
JmjC 143 309 2.3e-57 SMART
low complexity region 370 383 N/A INTRINSIC
low complexity region 417 434 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 100% (38/38)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit accumulation of histone 3 methylation in spermatids, a transient increase in testes size, wider tubules, occasional male germ cell apoptosis, and decreased body weight. However, fertility is normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahcyl1 C T 3: 107,675,085 G54D probably damaging Het
Aldh1b1 T C 4: 45,803,427 C322R probably damaging Het
Cdc14b T C 13: 64,215,563 I258V probably damaging Het
Cenph T C 13: 100,772,735 I55V probably benign Het
Cep290 T A 10: 100,569,144 probably null Het
Ces2b A G 8: 104,837,287 Y431C probably damaging Het
Cyp4f17 T C 17: 32,506,976 S28P possibly damaging Het
Cyp4f40 C G 17: 32,675,742 T427S possibly damaging Het
Exoc2 A G 13: 30,935,507 I137T probably benign Het
Fam168b C A 1: 34,836,741 G21V probably damaging Het
G3bp1 T A 11: 55,493,509 D168E probably benign Het
Gm765 T G 6: 98,248,208 H38P possibly damaging Het
Impg2 T A 16: 56,252,333 L376H probably damaging Het
Lonp1 C T 17: 56,619,230 V426M probably damaging Het
Lypla2 C A 4: 135,970,862 A26S probably benign Het
Map3k13 T C 16: 21,905,237 V323A possibly damaging Het
Mov10 A G 3: 104,818,044 L83P probably damaging Het
Mphosph9 G T 5: 124,260,116 A1039D probably damaging Het
Nedd1 T C 10: 92,698,337 K317R possibly damaging Het
Olfr1117-ps1 A G 2: 87,308,992 T68A possibly damaging Het
Pde3a T A 6: 141,479,346 S623T probably damaging Het
Pld1 T A 3: 28,041,199 M227K probably benign Het
Rell1 T G 5: 63,937,867 K85N probably damaging Het
Rhbdf1 T C 11: 32,215,652 T93A probably damaging Het
Sccpdh T A 1: 179,684,227 M88K possibly damaging Het
Siae T G 9: 37,642,799 probably null Het
Slc22a16 G A 10: 40,603,905 E637K unknown Het
Stk19 C T 17: 34,824,794 G95S probably benign Het
Stpg2 G A 3: 139,522,977 probably null Het
Sult2a5 T A 7: 13,624,132 F30I probably damaging Het
Svil A G 18: 5,082,853 E748G probably damaging Het
Swap70 T A 7: 110,269,919 H306Q probably benign Het
Try10 G A 6: 41,357,821 G227D probably damaging Het
Ttn T C 2: 76,896,369 probably benign Het
Ttn T A 2: 76,919,092 H3871L probably benign Het
Vmn1r231 T C 17: 20,890,483 I57V possibly damaging Het
Vpreb1 A G 16: 16,868,802 S75P probably damaging Het
Zkscan5 A G 5: 145,221,084 probably null Het
Other mutations in Kdm4d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01011:Kdm4d APN 9 14464219 missense probably benign 0.10
IGL01114:Kdm4d APN 9 14464197 missense probably damaging 1.00
IGL01609:Kdm4d APN 9 14464418 missense probably damaging 0.99
IGL02342:Kdm4d APN 9 14463564 missense probably damaging 0.99
IGL02513:Kdm4d APN 9 14464554 missense probably benign 0.00
IGL03276:Kdm4d APN 9 14464542 missense probably benign 0.04
IGL03379:Kdm4d APN 9 14463843 missense probably damaging 1.00
R0220:Kdm4d UTSW 9 14463122 missense probably benign
R0755:Kdm4d UTSW 9 14464295 missense probably damaging 0.99
R1195:Kdm4d UTSW 9 14463099 missense probably benign
R1195:Kdm4d UTSW 9 14463099 missense probably benign
R1195:Kdm4d UTSW 9 14463099 missense probably benign
R1455:Kdm4d UTSW 9 14464395 missense probably damaging 0.98
R1552:Kdm4d UTSW 9 14464029 missense probably damaging 1.00
R1692:Kdm4d UTSW 9 14464511 missense probably benign 0.43
R1871:Kdm4d UTSW 9 14464383 missense probably damaging 1.00
R1892:Kdm4d UTSW 9 14464317 missense probably benign 0.14
R4792:Kdm4d UTSW 9 14463390 missense probably benign
R5113:Kdm4d UTSW 9 14464113 missense probably damaging 1.00
R5211:Kdm4d UTSW 9 14463104 missense probably benign 0.04
R5352:Kdm4d UTSW 9 14464358 missense probably damaging 1.00
R7014:Kdm4d UTSW 9 14464179 missense probably damaging 0.99
R7198:Kdm4d UTSW 9 14464020 missense probably damaging 1.00
R7260:Kdm4d UTSW 9 14463158 missense probably benign 0.05
R8116:Kdm4d UTSW 9 14463941 missense probably damaging 1.00
R8134:Kdm4d UTSW 9 14463236 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAATGCAACCTCAGCTGGAAG -3'
(R):5'- GTCGTCCTTGTGAACTAGGAG -3'

Sequencing Primer
(F):5'- TTATCCAGAGGCTTGCCAAG -3'
(R):5'- CCTTGTGAACTAGGAGCTCAG -3'
Posted On2018-07-23