Mutagenetix > Incidental Mutation

Incidental Mutation 'R6692:Exoc2'

527924

Institutional Source

Beutler Lab

Gene Symbol

Exoc2

Ensembl Gene

ENSMUSG00000021357

Gene Name

exocyst complex component 2

Synonyms

2410030I24Rik, Sec5l1, Sec5

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.956) question?

Stock #

R6692 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

30813919-30974093 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 30935507 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 137 (I137T)

Ref Sequence

ENSEMBL: ENSMUSP00000100010 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021785] [ENSMUST00000102946]

AlphaFold

Q9D4H1

Predicted Effect

probably benign
Transcript: ENSMUST00000021785
AA Change: I137T

PolyPhen 2 Score 0.095 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000021785
Gene: ENSMUSG00000021357
AA Change: I137T

Domain	Start	End	E-Value	Type
Pfam:TIG	8	92	3.2e-10	PFAM
Pfam:Sec5	198	377	3.6e-59	PFAM
low complexity region	572	585	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000102946
AA Change: I137T

PolyPhen 2 Score 0.095 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000100010
Gene: ENSMUSG00000021357
AA Change: I137T

Domain	Start	End	E-Value	Type
Pfam:TIG	8	92	2.5e-10	PFAM
Pfam:Sec5	198	377	7.5e-59	PFAM
low complexity region	572	585	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000220532

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222133

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223216

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.0%
20x: 94.1%

Validation Efficiency

100% (38/38)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the exocyst complex, a multi-protein complex essential for the polarized targeting of exocytic vesicles to specific docking sites on the plasma membrane. Though best characterized in yeast, the component proteins and the functions of the exocyst complex have been demonstrated to be highly conserved in higher eukaryotes. At least eight components of the exocyst complex, including this protein, are found to interact with the actin cytoskeletal remodeling and vesicle transport machinery. This interaction has been shown to mediate filopodia formation in fibroblasts. This protein has been shown to interact with the Ral subfamily of GTPases and thereby mediate exocytosis by tethering vesicles to the plasma membrane. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2012]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ahcyl1	C	T	3: 107,675,085	G54D	probably damaging	Het
Aldh1b1	T	C	4: 45,803,427	C322R	probably damaging	Het
Cdc14b	T	C	13: 64,215,563	I258V	probably damaging	Het
Cenph	T	C	13: 100,772,735	I55V	probably benign	Het
Cep290	T	A	10: 100,569,144		probably null	Het
Ces2b	A	G	8: 104,837,287	Y431C	probably damaging	Het
Cyp4f17	T	C	17: 32,506,976	S28P	possibly damaging	Het
Cyp4f40	C	G	17: 32,675,742	T427S	possibly damaging	Het
Fam168b	C	A	1: 34,836,741	G21V	probably damaging	Het
G3bp1	T	A	11: 55,493,509	D168E	probably benign	Het
Gm765	T	G	6: 98,248,208	H38P	possibly damaging	Het
Impg2	T	A	16: 56,252,333	L376H	probably damaging	Het
Kdm4d	A	T	9: 14,463,065	M499K	probably benign	Het
Lonp1	C	T	17: 56,619,230	V426M	probably damaging	Het
Lypla2	C	A	4: 135,970,862	A26S	probably benign	Het
Map3k13	T	C	16: 21,905,237	V323A	possibly damaging	Het
Mov10	A	G	3: 104,818,044	L83P	probably damaging	Het
Mphosph9	G	T	5: 124,260,116	A1039D	probably damaging	Het
Nedd1	T	C	10: 92,698,337	K317R	possibly damaging	Het
Olfr1117-ps1	A	G	2: 87,308,992	T68A	possibly damaging	Het
Pde3a	T	A	6: 141,479,346	S623T	probably damaging	Het
Pld1	T	A	3: 28,041,199	M227K	probably benign	Het
Rell1	T	G	5: 63,937,867	K85N	probably damaging	Het
Rhbdf1	T	C	11: 32,215,652	T93A	probably damaging	Het
Sccpdh	T	A	1: 179,684,227	M88K	possibly damaging	Het
Siae	T	G	9: 37,642,799		probably null	Het
Slc22a16	G	A	10: 40,603,905	E637K	unknown	Het
Stk19	C	T	17: 34,824,794	G95S	probably benign	Het
Stpg2	G	A	3: 139,522,977		probably null	Het
Sult2a5	T	A	7: 13,624,132	F30I	probably damaging	Het
Svil	A	G	18: 5,082,853	E748G	probably damaging	Het
Swap70	T	A	7: 110,269,919	H306Q	probably benign	Het
Try10	G	A	6: 41,357,821	G227D	probably damaging	Het
Ttn	T	C	2: 76,896,369		probably benign	Het
Ttn	T	A	2: 76,919,092	H3871L	probably benign	Het
Vmn1r231	T	C	17: 20,890,483	I57V	possibly damaging	Het
Vpreb1	A	G	16: 16,868,802	S75P	probably damaging	Het
Zkscan5	A	G	5: 145,221,084		probably null	Het

Other mutations in Exoc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00095:Exoc2	APN	13	30820626	missense	probably benign	0.17
IGL01839:Exoc2	APN	13	30906799	missense	probably damaging	1.00
IGL02092:Exoc2	APN	13	30875277	missense	probably benign	0.09
IGL02245:Exoc2	APN	13	30906859	missense	probably benign	0.10
IGL02267:Exoc2	APN	13	30815321	missense	probably benign
IGL02478:Exoc2	APN	13	30927420	missense	probably benign
IGL02500:Exoc2	APN	13	30911196	missense	probably damaging	1.00
IGL03081:Exoc2	APN	13	30900902	missense	probably benign	0.28
IGL03112:Exoc2	APN	13	30906587	splice site	probably benign
IGL03409:Exoc2	APN	13	30940737	utr 5 prime	probably benign
R0284:Exoc2	UTSW	13	30877625	splice site	probably benign
R0452:Exoc2	UTSW	13	30886327	splice site	probably benign
R0826:Exoc2	UTSW	13	30856797	critical splice acceptor site	probably null
R1251:Exoc2	UTSW	13	30886276	missense	probably benign	0.03
R1367:Exoc2	UTSW	13	30882273	nonsense	probably null
R1501:Exoc2	UTSW	13	30935502	missense	probably benign	0.01
R1593:Exoc2	UTSW	13	30856761	missense	possibly damaging	0.64
R1839:Exoc2	UTSW	13	30906497	splice site	probably benign
R1872:Exoc2	UTSW	13	30822661	missense	probably benign	0.17
R2064:Exoc2	UTSW	13	30935561	missense	probably benign	0.00
R2070:Exoc2	UTSW	13	30815370	missense	probably benign	0.00
R2227:Exoc2	UTSW	13	30864884	missense	probably benign
R2507:Exoc2	UTSW	13	30882365	missense	possibly damaging	0.55
R3965:Exoc2	UTSW	13	30877582	missense	probably benign	0.00
R4601:Exoc2	UTSW	13	30882268	missense	probably benign	0.05
R4914:Exoc2	UTSW	13	30876813	missense	probably benign	0.21
R5299:Exoc2	UTSW	13	30871918	splice site	probably null
R5410:Exoc2	UTSW	13	30864856	missense	probably damaging	0.98
R5461:Exoc2	UTSW	13	30925755	missense	possibly damaging	0.66
R5956:Exoc2	UTSW	13	30820623	missense	probably benign	0.03
R6056:Exoc2	UTSW	13	30900829	missense	probably benign	0.03
R6107:Exoc2	UTSW	13	30876797	missense	probably benign
R6548:Exoc2	UTSW	13	30826064	missense	possibly damaging	0.86
R6969:Exoc2	UTSW	13	30911178	missense	probably benign
R7386:Exoc2	UTSW	13	30906663	splice site	probably null
R7461:Exoc2	UTSW	13	30882272	missense	probably benign	0.32
R7467:Exoc2	UTSW	13	30925733	missense	probably damaging	0.98
R7473:Exoc2	UTSW	13	30822630	critical splice donor site	probably null
R7613:Exoc2	UTSW	13	30882272	missense	probably benign	0.32
R7767:Exoc2	UTSW	13	30876769	missense	probably benign	0.01
R7793:Exoc2	UTSW	13	30911178	missense	probably benign	0.00
R7795:Exoc2	UTSW	13	30876773	nonsense	probably null
R7993:Exoc2	UTSW	13	30906730	critical splice donor site	probably null
R8085:Exoc2	UTSW	13	30940703	missense	probably damaging	1.00
R8330:Exoc2	UTSW	13	30877573	missense	probably benign
R8716:Exoc2	UTSW	13	30911244	missense	probably damaging	1.00
R8735:Exoc2	UTSW	13	30906839	missense	probably damaging	1.00
R8922:Exoc2	UTSW	13	30871855	missense	probably benign	0.05
R9237:Exoc2	UTSW	13	30864875	missense	probably benign
R9243:Exoc2	UTSW	13	30925795	missense	probably benign	0.03
R9365:Exoc2	UTSW	13	30856714	missense	probably benign	0.00
R9731:Exoc2	UTSW	13	30877250	missense	probably benign	0.06

Predicted Primers

PCR Primer
(F):5'- GACTGAAGCAAAACTTGTTAAGCC -3'
(R):5'- CCAGCAGGCATGTAAAGAAC -3'

Sequencing Primer
(F):5'- GAAGCAAAACTTGTTAAGCCTCATAC -3'
(R):5'- TGAGCTGTAGTATCCTTAAGTCTC -3'

Posted On

2018-07-23