Incidental Mutation 'R6692:Cdc14b'
ID527925
Institutional Source Beutler Lab
Gene Symbol Cdc14b
Ensembl Gene ENSMUSG00000033102
Gene NameCDC14 cell division cycle 14B
SynonymsA530086E13Rik, 2810432N10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.378) question?
Stock #R6692 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location64189268-64275290 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 64215563 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 258 (I258V)
Ref Sequence ENSEMBL: ENSMUSP00000105391 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039318] [ENSMUST00000109769] [ENSMUST00000109770] [ENSMUST00000221139] [ENSMUST00000221634]
Predicted Effect possibly damaging
Transcript: ENSMUST00000039318
AA Change: I295V

PolyPhen 2 Score 0.542 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000046003
Gene: ENSMUSG00000033102
AA Change: I295V

DomainStartEndE-ValueType
low complexity region 15 34 N/A INTRINSIC
Pfam:DSPn 51 189 6.1e-57 PFAM
Pfam:DSPc 240 365 9.2e-17 PFAM
Pfam:Y_phosphatase 244 365 1e-7 PFAM
transmembrane domain 445 467 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109769
AA Change: I258V

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000105391
Gene: ENSMUSG00000033102
AA Change: I258V

DomainStartEndE-ValueType
Pfam:DSPn 12 152 2.5e-58 PFAM
Pfam:DSPc 203 328 8e-17 PFAM
Pfam:Y_phosphatase 206 328 8.9e-8 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000109770
AA Change: I295V

PolyPhen 2 Score 0.542 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000105392
Gene: ENSMUSG00000033102
AA Change: I295V

DomainStartEndE-ValueType
low complexity region 15 34 N/A INTRINSIC
Pfam:DSPn 51 189 3.4e-57 PFAM
Pfam:DSPc 240 365 2.8e-16 PFAM
Pfam:Y_phosphatase 252 364 2.4e-7 PFAM
transmembrane domain 445 467 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000221139
AA Change: I295V

PolyPhen 2 Score 0.542 (Sensitivity: 0.88; Specificity: 0.91)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221437
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221567
Predicted Effect probably benign
Transcript: ENSMUST00000221634
AA Change: I295V

PolyPhen 2 Score 0.234 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223116
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the dual specificity protein tyrosine phosphatase family. This protein is highly similar to Saccharomyces cerevisiae Cdc14, a protein tyrosine phosphatase involved in the exit of cell mitosis and initiation of DNA replication, which suggests the role in cell cycle control. This protein has been shown to interact with and dephosphorylates tumor suppressor protein p53, and is thought to regulate the function of p53. Alternative splice of this gene results in 3 transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit premature aging, including premature cataracts and kyphosis; reduced fertility, particularly in female mice; and impaired contextual conditioning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahcyl1 C T 3: 107,675,085 G54D probably damaging Het
Aldh1b1 T C 4: 45,803,427 C322R probably damaging Het
Cenph T C 13: 100,772,735 I55V probably benign Het
Cep290 T A 10: 100,569,144 probably null Het
Ces2b A G 8: 104,837,287 Y431C probably damaging Het
Cyp4f17 T C 17: 32,506,976 S28P possibly damaging Het
Cyp4f40 C G 17: 32,675,742 T427S possibly damaging Het
Exoc2 A G 13: 30,935,507 I137T probably benign Het
Fam168b C A 1: 34,836,741 G21V probably damaging Het
G3bp1 T A 11: 55,493,509 D168E probably benign Het
Gm765 T G 6: 98,248,208 H38P possibly damaging Het
Impg2 T A 16: 56,252,333 L376H probably damaging Het
Kdm4d A T 9: 14,463,065 M499K probably benign Het
Lonp1 C T 17: 56,619,230 V426M probably damaging Het
Lypla2 C A 4: 135,970,862 A26S probably benign Het
Map3k13 T C 16: 21,905,237 V323A possibly damaging Het
Mov10 A G 3: 104,818,044 L83P probably damaging Het
Mphosph9 G T 5: 124,260,116 A1039D probably damaging Het
Nedd1 T C 10: 92,698,337 K317R possibly damaging Het
Olfr1117-ps1 A G 2: 87,308,992 T68A possibly damaging Het
Pde3a T A 6: 141,479,346 S623T probably damaging Het
Pld1 T A 3: 28,041,199 M227K probably benign Het
Rell1 T G 5: 63,937,867 K85N probably damaging Het
Rhbdf1 T C 11: 32,215,652 T93A probably damaging Het
Sccpdh T A 1: 179,684,227 M88K possibly damaging Het
Siae T G 9: 37,642,799 probably null Het
Slc22a16 G A 10: 40,603,905 E637K unknown Het
Stk19 C T 17: 34,824,794 G95S probably benign Het
Stpg2 G A 3: 139,522,977 probably null Het
Sult2a5 T A 7: 13,624,132 F30I probably damaging Het
Svil A G 18: 5,082,853 E748G probably damaging Het
Swap70 T A 7: 110,269,919 H306Q probably benign Het
Try10 G A 6: 41,357,821 G227D probably damaging Het
Ttn T C 2: 76,896,369 probably benign Het
Ttn T A 2: 76,919,092 H3871L probably benign Het
Vmn1r231 T C 17: 20,890,483 I57V possibly damaging Het
Vpreb1 A G 16: 16,868,802 S75P probably damaging Het
Zkscan5 A G 5: 145,221,084 probably null Het
Other mutations in Cdc14b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00778:Cdc14b APN 13 64215656 missense probably damaging 1.00
IGL00816:Cdc14b APN 13 64205403 missense probably benign 0.10
IGL02569:Cdc14b APN 13 64225614 missense probably benign 0.36
IGL02634:Cdc14b APN 13 64216303 splice site probably benign
IGL02897:Cdc14b APN 13 64247253 missense probably benign 0.00
R0390:Cdc14b UTSW 13 64210192 unclassified probably benign
R0542:Cdc14b UTSW 13 64243683 missense probably benign 0.01
R1022:Cdc14b UTSW 13 64215676 missense probably damaging 1.00
R1024:Cdc14b UTSW 13 64215676 missense probably damaging 1.00
R1676:Cdc14b UTSW 13 64225602 missense possibly damaging 0.93
R1945:Cdc14b UTSW 13 64219890 missense probably damaging 1.00
R1964:Cdc14b UTSW 13 64215537 missense probably damaging 1.00
R3162:Cdc14b UTSW 13 64246608 splice site probably benign
R4359:Cdc14b UTSW 13 64248411 missense probably benign 0.27
R4598:Cdc14b UTSW 13 64247274 missense probably benign
R4716:Cdc14b UTSW 13 64209200 missense probably damaging 1.00
R6196:Cdc14b UTSW 13 64205524 intron probably benign
R6219:Cdc14b UTSW 13 64205524 intron probably benign
R6361:Cdc14b UTSW 13 64216209 splice site probably null
R6480:Cdc14b UTSW 13 64225650 critical splice acceptor site probably null
R6565:Cdc14b UTSW 13 64225630 missense probably benign 0.01
R7204:Cdc14b UTSW 13 64210198 missense possibly damaging 0.83
R7327:Cdc14b UTSW 13 64225647 missense probably damaging 1.00
R7464:Cdc14b UTSW 13 64196675 nonsense probably null
R7639:Cdc14b UTSW 13 64205329 missense possibly damaging 0.96
R7687:Cdc14b UTSW 13 64209193 missense probably benign 0.15
Z1176:Cdc14b UTSW 13 64274669 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- GGATTTTAAAATCGCTCTTTCTGGG -3'
(R):5'- TTACCACCAACATTCTCCGG -3'

Sequencing Primer
(F):5'- AAAATCGCTCTTTCTGGGAAGCC -3'
(R):5'- AACATTCTCCGGAGACTTATATTCC -3'
Posted On2018-07-23