Incidental Mutation 'R6692:Cenph'
ID527926
Institutional Source Beutler Lab
Gene Symbol Cenph
Ensembl Gene ENSMUSG00000045273
Gene Namecentromere protein H
Synonyms2810046K12Rik, CENP-H, 2610042E16Rik, 1700021I11Rik, 2410018A12Rik, ENP
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6692 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location100759674-100775899 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 100772735 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 55 (I55V)
Ref Sequence ENSEMBL: ENSMUSP00000074988 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075550]
Predicted Effect probably benign
Transcript: ENSMUST00000075550
AA Change: I55V

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000074988
Gene: ENSMUSG00000045273
AA Change: I55V

DomainStartEndE-ValueType
coiled coil region 63 101 N/A INTRINSIC
Pfam:CENP-H 133 233 1.3e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000077495
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136694
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Centromere and kinetochore proteins play a critical role in centromere structure, kinetochore formation, and sister chromatid separation. The protein encoded by this gene colocalizes with inner kinetochore plate proteins CENP-A and CENP-C in both interphase and metaphase. It localizes outside of centromeric heterochromatin, where CENP-B is localized, and inside the kinetochore corona, where CENP-E is localized during prometaphase. It is thought that this protein can bind to itself, as well as to CENP-A, CENP-B or CENP-C. Multimers of the protein localize constitutively to the inner kinetochore plate and play an important role in the organization and function of the active centromere-kinetochore complex. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahcyl1 C T 3: 107,675,085 G54D probably damaging Het
Aldh1b1 T C 4: 45,803,427 C322R probably damaging Het
Cdc14b T C 13: 64,215,563 I258V probably damaging Het
Cep290 T A 10: 100,569,144 probably null Het
Ces2b A G 8: 104,837,287 Y431C probably damaging Het
Cyp4f17 T C 17: 32,506,976 S28P possibly damaging Het
Cyp4f40 C G 17: 32,675,742 T427S possibly damaging Het
Exoc2 A G 13: 30,935,507 I137T probably benign Het
Fam168b C A 1: 34,836,741 G21V probably damaging Het
G3bp1 T A 11: 55,493,509 D168E probably benign Het
Gm765 T G 6: 98,248,208 H38P possibly damaging Het
Impg2 T A 16: 56,252,333 L376H probably damaging Het
Kdm4d A T 9: 14,463,065 M499K probably benign Het
Lonp1 C T 17: 56,619,230 V426M probably damaging Het
Lypla2 C A 4: 135,970,862 A26S probably benign Het
Map3k13 T C 16: 21,905,237 V323A possibly damaging Het
Mov10 A G 3: 104,818,044 L83P probably damaging Het
Mphosph9 G T 5: 124,260,116 A1039D probably damaging Het
Nedd1 T C 10: 92,698,337 K317R possibly damaging Het
Olfr1117-ps1 A G 2: 87,308,992 T68A possibly damaging Het
Pde3a T A 6: 141,479,346 S623T probably damaging Het
Pld1 T A 3: 28,041,199 M227K probably benign Het
Rell1 T G 5: 63,937,867 K85N probably damaging Het
Rhbdf1 T C 11: 32,215,652 T93A probably damaging Het
Sccpdh T A 1: 179,684,227 M88K possibly damaging Het
Siae T G 9: 37,642,799 probably null Het
Slc22a16 G A 10: 40,603,905 E637K unknown Het
Stk19 C T 17: 34,824,794 G95S probably benign Het
Stpg2 G A 3: 139,522,977 probably null Het
Sult2a5 T A 7: 13,624,132 F30I probably damaging Het
Svil A G 18: 5,082,853 E748G probably damaging Het
Swap70 T A 7: 110,269,919 H306Q probably benign Het
Try10 G A 6: 41,357,821 G227D probably damaging Het
Ttn T C 2: 76,896,369 probably benign Het
Ttn T A 2: 76,919,092 H3871L probably benign Het
Vmn1r231 T C 17: 20,890,483 I57V possibly damaging Het
Vpreb1 A G 16: 16,868,802 S75P probably damaging Het
Zkscan5 A G 5: 145,221,084 probably null Het
Other mutations in Cenph
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02202:Cenph APN 13 100761873 missense probably benign 0.08
IGL02392:Cenph APN 13 100772761 missense probably benign 0.35
R0544:Cenph UTSW 13 100772741 missense probably damaging 0.99
R2507:Cenph UTSW 13 100771236 missense probably benign 0.00
R3974:Cenph UTSW 13 100763567 missense probably damaging 0.97
R5251:Cenph UTSW 13 100761840 missense possibly damaging 0.79
R5333:Cenph UTSW 13 100761772 missense probably benign 0.02
R7143:Cenph UTSW 13 100761777 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- GGCTGGAGATGGCTCAGAG -3'
(R):5'- ATCCATTTTATGTCGCCGTCTTG -3'

Sequencing Primer
(F):5'- GAGCACCTAGGTGATAGCTCATAAC -3'
(R):5'- GCCAACTATTTTAAATAAAGCGAGGC -3'
Posted On2018-07-23