Incidental Mutation 'R6692:Vpreb1'
ID527927
Institutional Source Beutler Lab
Gene Symbol Vpreb1
Ensembl Gene ENSMUSG00000059305
Gene Namepre-B lymphocyte gene 1
SynonymsVpreb-1, CD179a
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R6692 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location16868403-16870843 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 16868802 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 75 (S75P)
Ref Sequence ENSEMBL: ENSMUSP00000074537 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023465] [ENSMUST00000075017] [ENSMUST00000100136] [ENSMUST00000231812] [ENSMUST00000232017] [ENSMUST00000232080] [ENSMUST00000232200] [ENSMUST00000232231] [ENSMUST00000232547] [ENSMUST00000232581]
Predicted Effect probably benign
Transcript: ENSMUST00000023465
SMART Domains Protein: ENSMUSP00000023465
Gene: ENSMUSG00000022779

DomainStartEndE-ValueType
TOPRIM 3 138 2.64e-27 SMART
TOP1Bc 146 242 3.84e-38 SMART
TOP1Ac 289 545 2.28e-104 SMART
low complexity region 824 850 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000075017
AA Change: S75P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000074537
Gene: ENSMUSG00000059305
AA Change: S75P

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGv 36 117 3.96e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000100136
SMART Domains Protein: ENSMUSP00000097713
Gene: ENSMUSG00000075370

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
IGc1 126 200 2.17e-31 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231278
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231345
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231439
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231576
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231704
Predicted Effect probably benign
Transcript: ENSMUST00000231812
Predicted Effect probably benign
Transcript: ENSMUST00000232017
Predicted Effect probably benign
Transcript: ENSMUST00000232080
Predicted Effect probably benign
Transcript: ENSMUST00000232200
Predicted Effect probably benign
Transcript: ENSMUST00000232231
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232380
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232531
Predicted Effect probably benign
Transcript: ENSMUST00000232547
Predicted Effect probably benign
Transcript: ENSMUST00000232581
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232670
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 100% (38/38)
MGI Phenotype PHENOTYPE: Homozygous null mutants have fewer cells with functional pre-B cell receptors. Double knockouts homozygous for null mutations at Vpreb1 and Vpreb2 show impaired B-cell development. Fewer B-cells are found in bone marrow, spleen and peritoneum. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahcyl1 C T 3: 107,675,085 G54D probably damaging Het
Aldh1b1 T C 4: 45,803,427 C322R probably damaging Het
Cdc14b T C 13: 64,215,563 I258V probably damaging Het
Cenph T C 13: 100,772,735 I55V probably benign Het
Cep290 T A 10: 100,569,144 probably null Het
Ces2b A G 8: 104,837,287 Y431C probably damaging Het
Cyp4f17 T C 17: 32,506,976 S28P possibly damaging Het
Cyp4f40 C G 17: 32,675,742 T427S possibly damaging Het
Exoc2 A G 13: 30,935,507 I137T probably benign Het
Fam168b C A 1: 34,836,741 G21V probably damaging Het
G3bp1 T A 11: 55,493,509 D168E probably benign Het
Gm765 T G 6: 98,248,208 H38P possibly damaging Het
Impg2 T A 16: 56,252,333 L376H probably damaging Het
Kdm4d A T 9: 14,463,065 M499K probably benign Het
Lonp1 C T 17: 56,619,230 V426M probably damaging Het
Lypla2 C A 4: 135,970,862 A26S probably benign Het
Map3k13 T C 16: 21,905,237 V323A possibly damaging Het
Mov10 A G 3: 104,818,044 L83P probably damaging Het
Mphosph9 G T 5: 124,260,116 A1039D probably damaging Het
Nedd1 T C 10: 92,698,337 K317R possibly damaging Het
Olfr1117-ps1 A G 2: 87,308,992 T68A possibly damaging Het
Pde3a T A 6: 141,479,346 S623T probably damaging Het
Pld1 T A 3: 28,041,199 M227K probably benign Het
Rell1 T G 5: 63,937,867 K85N probably damaging Het
Rhbdf1 T C 11: 32,215,652 T93A probably damaging Het
Sccpdh T A 1: 179,684,227 M88K possibly damaging Het
Siae T G 9: 37,642,799 probably null Het
Slc22a16 G A 10: 40,603,905 E637K unknown Het
Stk19 C T 17: 34,824,794 G95S probably benign Het
Stpg2 G A 3: 139,522,977 probably null Het
Sult2a5 T A 7: 13,624,132 F30I probably damaging Het
Svil A G 18: 5,082,853 E748G probably damaging Het
Swap70 T A 7: 110,269,919 H306Q probably benign Het
Try10 G A 6: 41,357,821 G227D probably damaging Het
Ttn T C 2: 76,896,369 probably benign Het
Ttn T A 2: 76,919,092 H3871L probably benign Het
Vmn1r231 T C 17: 20,890,483 I57V possibly damaging Het
Zkscan5 A G 5: 145,221,084 probably null Het
Other mutations in Vpreb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01141:Vpreb1 APN 16 16869087 missense probably benign 0.00
IGL02232:Vpreb1 APN 16 16868739 missense possibly damaging 0.95
R1824:Vpreb1 UTSW 16 16869071 unclassified probably null
R1836:Vpreb1 UTSW 16 16869069 missense probably benign 0.17
R3625:Vpreb1 UTSW 16 16868804 missense probably benign 0.01
R5239:Vpreb1 UTSW 16 16868728 nonsense probably null
R5446:Vpreb1 UTSW 16 16868690 missense probably damaging 0.99
R6996:Vpreb1 UTSW 16 16868814 missense probably damaging 1.00
R7388:Vpreb1 UTSW 16 16868652 missense probably benign
Predicted Primers PCR Primer
(F):5'- AATGTCTCCAGAGCCTAAGATCCC -3'
(R):5'- ATCTTCTCAGGTTGTGGCCC -3'

Sequencing Primer
(F):5'- GCCTAAGATCCCAAATCTGTATACG -3'
(R):5'- CTCAGCCCATGGTGCATCAG -3'
Posted On2018-07-23