Incidental Mutation 'R6692:Map3k13'
ID527928
Institutional Source Beutler Lab
Gene Symbol Map3k13
Ensembl Gene ENSMUSG00000033618
Gene Namemitogen-activated protein kinase kinase kinase 13
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6692 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location21794346-21933439 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 21905237 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 323 (V323A)
Ref Sequence ENSEMBL: ENSMUSP00000156202 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042065] [ENSMUST00000231988] [ENSMUST00000232240]
Predicted Effect possibly damaging
Transcript: ENSMUST00000042065
AA Change: V323A

PolyPhen 2 Score 0.662 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000047388
Gene: ENSMUSG00000033618
AA Change: V323A

DomainStartEndE-ValueType
low complexity region 7 18 N/A INTRINSIC
low complexity region 119 137 N/A INTRINSIC
Pfam:Pkinase 167 406 3.1e-60 PFAM
Pfam:Pkinase_Tyr 167 406 2.4e-65 PFAM
coiled coil region 456 502 N/A INTRINSIC
low complexity region 578 599 N/A INTRINSIC
low complexity region 632 649 N/A INTRINSIC
low complexity region 805 821 N/A INTRINSIC
low complexity region 833 843 N/A INTRINSIC
low complexity region 932 945 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180401
Predicted Effect possibly damaging
Transcript: ENSMUST00000231988
AA Change: V323A

PolyPhen 2 Score 0.662 (Sensitivity: 0.86; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000232240
AA Change: V323A

PolyPhen 2 Score 0.662 (Sensitivity: 0.86; Specificity: 0.91)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of serine/threonine protein kinase family. This kinase contains a dual leucine-zipper motif, and has been shown to form dimers/oligomers through its leucine-zipper motif. This kinase can phosphorylate and activate MAPK8/JNK, MAP2K7/MKK7, which suggests a role in the JNK signaling pathway. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahcyl1 C T 3: 107,675,085 G54D probably damaging Het
Aldh1b1 T C 4: 45,803,427 C322R probably damaging Het
Cdc14b T C 13: 64,215,563 I258V probably damaging Het
Cenph T C 13: 100,772,735 I55V probably benign Het
Cep290 T A 10: 100,569,144 probably null Het
Ces2b A G 8: 104,837,287 Y431C probably damaging Het
Cyp4f17 T C 17: 32,506,976 S28P possibly damaging Het
Cyp4f40 C G 17: 32,675,742 T427S possibly damaging Het
Exoc2 A G 13: 30,935,507 I137T probably benign Het
Fam168b C A 1: 34,836,741 G21V probably damaging Het
G3bp1 T A 11: 55,493,509 D168E probably benign Het
Gm765 T G 6: 98,248,208 H38P possibly damaging Het
Impg2 T A 16: 56,252,333 L376H probably damaging Het
Kdm4d A T 9: 14,463,065 M499K probably benign Het
Lonp1 C T 17: 56,619,230 V426M probably damaging Het
Lypla2 C A 4: 135,970,862 A26S probably benign Het
Mov10 A G 3: 104,818,044 L83P probably damaging Het
Mphosph9 G T 5: 124,260,116 A1039D probably damaging Het
Nedd1 T C 10: 92,698,337 K317R possibly damaging Het
Olfr1117-ps1 A G 2: 87,308,992 T68A possibly damaging Het
Pde3a T A 6: 141,479,346 S623T probably damaging Het
Pld1 T A 3: 28,041,199 M227K probably benign Het
Rell1 T G 5: 63,937,867 K85N probably damaging Het
Rhbdf1 T C 11: 32,215,652 T93A probably damaging Het
Sccpdh T A 1: 179,684,227 M88K possibly damaging Het
Siae T G 9: 37,642,799 probably null Het
Slc22a16 G A 10: 40,603,905 E637K unknown Het
Stk19 C T 17: 34,824,794 G95S probably benign Het
Stpg2 G A 3: 139,522,977 probably null Het
Sult2a5 T A 7: 13,624,132 F30I probably damaging Het
Svil A G 18: 5,082,853 E748G probably damaging Het
Swap70 T A 7: 110,269,919 H306Q probably benign Het
Try10 G A 6: 41,357,821 G227D probably damaging Het
Ttn T C 2: 76,896,369 probably benign Het
Ttn T A 2: 76,919,092 H3871L probably benign Het
Vmn1r231 T C 17: 20,890,483 I57V possibly damaging Het
Vpreb1 A G 16: 16,868,802 S75P probably damaging Het
Zkscan5 A G 5: 145,221,084 probably null Het
Other mutations in Map3k13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00977:Map3k13 APN 16 21921764 missense probably benign 0.00
IGL01092:Map3k13 APN 16 21928016 missense probably damaging 0.97
IGL01958:Map3k13 APN 16 21892123 missense probably benign
IGL02444:Map3k13 APN 16 21914232 missense probably benign 0.19
IGL02503:Map3k13 APN 16 21908704 missense possibly damaging 0.50
IGL02712:Map3k13 APN 16 21905255 missense probably damaging 0.99
IGL03342:Map3k13 APN 16 21892231 missense possibly damaging 0.94
R0086:Map3k13 UTSW 16 21914225 missense probably damaging 0.98
R0124:Map3k13 UTSW 16 21903756 missense possibly damaging 0.95
R0281:Map3k13 UTSW 16 21914157 missense probably damaging 1.00
R0308:Map3k13 UTSW 16 21891988 missense probably benign
R0601:Map3k13 UTSW 16 21905249 missense possibly damaging 0.95
R0669:Map3k13 UTSW 16 21906524 missense probably benign 0.03
R0918:Map3k13 UTSW 16 21926240 missense probably damaging 1.00
R1641:Map3k13 UTSW 16 21903792 missense probably damaging 1.00
R1838:Map3k13 UTSW 16 21914189 missense possibly damaging 0.92
R1891:Map3k13 UTSW 16 21911086 missense probably damaging 1.00
R2125:Map3k13 UTSW 16 21892144 missense probably benign 0.01
R2332:Map3k13 UTSW 16 21898677 splice site probably null
R2361:Map3k13 UTSW 16 21906536 missense probably benign 0.05
R4395:Map3k13 UTSW 16 21898571 missense possibly damaging 0.49
R4505:Map3k13 UTSW 16 21922178 missense probably benign 0.00
R4506:Map3k13 UTSW 16 21922178 missense probably benign 0.00
R4521:Map3k13 UTSW 16 21905775 missense possibly damaging 0.94
R4753:Map3k13 UTSW 16 21892002 missense probably benign
R4952:Map3k13 UTSW 16 21911019 missense probably benign 0.15
R5035:Map3k13 UTSW 16 21921671 missense probably benign 0.03
R5327:Map3k13 UTSW 16 21921647 missense possibly damaging 0.89
R5784:Map3k13 UTSW 16 21898641 missense possibly damaging 0.68
R5831:Map3k13 UTSW 16 21928048 makesense probably null
R5996:Map3k13 UTSW 16 21905245 missense possibly damaging 0.95
R6007:Map3k13 UTSW 16 21905183 missense possibly damaging 0.95
R6546:Map3k13 UTSW 16 21921777 missense probably benign 0.15
R6620:Map3k13 UTSW 16 21892311 missense possibly damaging 0.62
R6683:Map3k13 UTSW 16 21892312 missense probably benign 0.32
R6695:Map3k13 UTSW 16 21922278 missense probably benign 0.10
R6743:Map3k13 UTSW 16 21892423 missense probably damaging 0.98
R6822:Map3k13 UTSW 16 21922263 missense probably benign 0.00
R6965:Map3k13 UTSW 16 21922150 missense probably benign
R7149:Map3k13 UTSW 16 21925437 missense probably benign 0.04
R7174:Map3k13 UTSW 16 21926256 missense probably damaging 1.00
R7256:Map3k13 UTSW 16 21892238 missense probably benign 0.03
R7400:Map3k13 UTSW 16 21922322 missense probably damaging 1.00
R7733:Map3k13 UTSW 16 21921686 missense probably damaging 1.00
R7848:Map3k13 UTSW 16 21905871 missense probably damaging 0.98
R7871:Map3k13 UTSW 16 21921596 missense probably benign 0.09
R7876:Map3k13 UTSW 16 21922319 missense probably benign 0.00
R7931:Map3k13 UTSW 16 21905871 missense probably damaging 0.98
R7954:Map3k13 UTSW 16 21921596 missense probably benign 0.09
R7959:Map3k13 UTSW 16 21922319 missense probably benign 0.00
R8002:Map3k13 UTSW 16 21905128 missense probably benign 0.05
R8089:Map3k13 UTSW 16 21903817 missense possibly damaging 0.48
Z1176:Map3k13 UTSW 16 21905162 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAACTGAACTCTGCAGCGTG -3'
(R):5'- GAACCGATCCTGGGTCAAAC -3'

Sequencing Primer
(F):5'- AACTCTGCAGCGTGGAAGC -3'
(R):5'- CGATCCTGGGTCAAACCTTAG -3'
Posted On2018-07-23