Incidental Mutation 'R6692:Vmn1r231'
ID 527930
Institutional Source Beutler Lab
Gene Symbol Vmn1r231
Ensembl Gene ENSMUSG00000050933
Gene Name vomeronasal 1 receptor 231
Synonyms V1re7
MMRRC Submission 044810-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.052) question?
Stock # R6692 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 21109978-21110913 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 21110745 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 57 (I57V)
Ref Sequence ENSEMBL: ENSMUSP00000056228 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061278]
AlphaFold Q8R2A3
Predicted Effect possibly damaging
Transcript: ENSMUST00000061278
AA Change: I57V

PolyPhen 2 Score 0.461 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000056228
Gene: ENSMUSG00000050933
AA Change: I57V

DomainStartEndE-ValueType
Pfam:TAS2R 6 294 1.6e-13 PFAM
Pfam:V1R 36 297 1.6e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232004
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 100% (38/38)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahcyl1 C T 3: 107,582,401 (GRCm39) G54D probably damaging Het
Aldh1b1 T C 4: 45,803,427 (GRCm39) C322R probably damaging Het
Cdc14b T C 13: 64,363,377 (GRCm39) I258V probably damaging Het
Cenph T C 13: 100,909,243 (GRCm39) I55V probably benign Het
Cep290 T A 10: 100,405,006 (GRCm39) probably null Het
Ces2b A G 8: 105,563,919 (GRCm39) Y431C probably damaging Het
Cyp4f17 T C 17: 32,725,950 (GRCm39) S28P possibly damaging Het
Cyp4f40 C G 17: 32,894,716 (GRCm39) T427S possibly damaging Het
Exoc2 A G 13: 31,119,490 (GRCm39) I137T probably benign Het
Fam168b C A 1: 34,875,822 (GRCm39) G21V probably damaging Het
G3bp1 T A 11: 55,384,335 (GRCm39) D168E probably benign Het
Impg2 T A 16: 56,072,696 (GRCm39) L376H probably damaging Het
Kdm4d A T 9: 14,374,361 (GRCm39) M499K probably benign Het
Lonp1 C T 17: 56,926,230 (GRCm39) V426M probably damaging Het
Lypla2 C A 4: 135,698,173 (GRCm39) A26S probably benign Het
Map3k13 T C 16: 21,723,987 (GRCm39) V323A possibly damaging Het
Mdfic2 T G 6: 98,225,169 (GRCm39) H38P possibly damaging Het
Mov10 A G 3: 104,725,360 (GRCm39) L83P probably damaging Het
Mphosph9 G T 5: 124,398,179 (GRCm39) A1039D probably damaging Het
Nedd1 T C 10: 92,534,199 (GRCm39) K317R possibly damaging Het
Or10ag55-ps1 A G 2: 87,139,336 (GRCm39) T68A possibly damaging Het
Pde3a T A 6: 141,425,072 (GRCm39) S623T probably damaging Het
Pld1 T A 3: 28,095,348 (GRCm39) M227K probably benign Het
Rell1 T G 5: 64,095,210 (GRCm39) K85N probably damaging Het
Rhbdf1 T C 11: 32,165,652 (GRCm39) T93A probably damaging Het
Sccpdh T A 1: 179,511,792 (GRCm39) M88K possibly damaging Het
Siae T G 9: 37,554,095 (GRCm39) probably null Het
Slc22a16 G A 10: 40,479,901 (GRCm39) E637K unknown Het
Stk19 C T 17: 35,043,770 (GRCm39) G95S probably benign Het
Stpg2 G A 3: 139,228,738 (GRCm39) probably null Het
Sult2a5 T A 7: 13,358,057 (GRCm39) F30I probably damaging Het
Svil A G 18: 5,082,853 (GRCm39) E748G probably damaging Het
Swap70 T A 7: 109,869,126 (GRCm39) H306Q probably benign Het
Try10 G A 6: 41,334,755 (GRCm39) G227D probably damaging Het
Ttn T C 2: 76,726,713 (GRCm39) probably benign Het
Ttn T A 2: 76,749,436 (GRCm39) H3871L probably benign Het
Vpreb1a A G 16: 16,686,666 (GRCm39) S75P probably damaging Het
Zkscan5 A G 5: 145,157,894 (GRCm39) probably null Het
Other mutations in Vmn1r231
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Vmn1r231 APN 17 21,110,828 (GRCm39) missense possibly damaging 0.68
IGL02124:Vmn1r231 APN 17 21,110,568 (GRCm39) missense probably damaging 1.00
IGL02151:Vmn1r231 APN 17 21,109,997 (GRCm39) missense probably benign 0.06
R0066:Vmn1r231 UTSW 17 21,109,998 (GRCm39) missense probably benign 0.27
R0066:Vmn1r231 UTSW 17 21,109,998 (GRCm39) missense probably benign 0.27
R0396:Vmn1r231 UTSW 17 21,110,661 (GRCm39) missense probably damaging 0.98
R0427:Vmn1r231 UTSW 17 21,110,490 (GRCm39) missense probably benign 0.05
R0470:Vmn1r231 UTSW 17 21,110,265 (GRCm39) nonsense probably null
R0848:Vmn1r231 UTSW 17 21,110,433 (GRCm39) missense probably damaging 1.00
R1692:Vmn1r231 UTSW 17 21,110,871 (GRCm39) missense probably benign 0.02
R1987:Vmn1r231 UTSW 17 21,110,212 (GRCm39) missense probably damaging 1.00
R1988:Vmn1r231 UTSW 17 21,110,212 (GRCm39) missense probably damaging 1.00
R2105:Vmn1r231 UTSW 17 21,110,380 (GRCm39) missense possibly damaging 0.66
R4440:Vmn1r231 UTSW 17 21,110,718 (GRCm39) missense possibly damaging 0.48
R4634:Vmn1r231 UTSW 17 21,110,660 (GRCm39) missense possibly damaging 0.46
R4646:Vmn1r231 UTSW 17 21,110,571 (GRCm39) missense probably damaging 1.00
R4678:Vmn1r231 UTSW 17 21,110,489 (GRCm39) missense possibly damaging 0.94
R4696:Vmn1r231 UTSW 17 21,110,901 (GRCm39) missense possibly damaging 0.63
R4938:Vmn1r231 UTSW 17 21,110,613 (GRCm39) missense possibly damaging 0.76
R5544:Vmn1r231 UTSW 17 21,110,840 (GRCm39) missense probably damaging 1.00
R5942:Vmn1r231 UTSW 17 21,110,417 (GRCm39) missense possibly damaging 0.83
R6053:Vmn1r231 UTSW 17 21,110,081 (GRCm39) missense probably damaging 1.00
R6712:Vmn1r231 UTSW 17 21,109,992 (GRCm39) missense possibly damaging 0.54
R7131:Vmn1r231 UTSW 17 21,110,140 (GRCm39) missense possibly damaging 0.87
R7854:Vmn1r231 UTSW 17 21,110,894 (GRCm39) missense probably damaging 0.98
R7918:Vmn1r231 UTSW 17 21,110,236 (GRCm39) nonsense probably null
R8187:Vmn1r231 UTSW 17 21,110,893 (GRCm39) missense probably benign 0.10
R8238:Vmn1r231 UTSW 17 21,110,640 (GRCm39) missense probably benign 0.08
R8313:Vmn1r231 UTSW 17 21,110,289 (GRCm39) missense probably benign 0.02
R8525:Vmn1r231 UTSW 17 21,110,001 (GRCm39) missense probably benign 0.06
R9276:Vmn1r231 UTSW 17 21,110,560 (GRCm39) missense probably benign 0.00
RF010:Vmn1r231 UTSW 17 21,110,255 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATGGCCTGGAAGACACTCAAG -3'
(R):5'- TCCACTGCCTAATGGTAAAACATC -3'

Sequencing Primer
(F):5'- CACTCAAGAGACAGATGGTACCAATG -3'
(R):5'- ACATCATTTTGGTCAGAGAAGTG -3'
Posted On 2018-07-23