Incidental Mutation 'R6692:Vmn1r231'
ID527930
Institutional Source Beutler Lab
Gene Symbol Vmn1r231
Ensembl Gene ENSMUSG00000050933
Gene Namevomeronasal 1 receptor 231
SynonymsV1re7
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R6692 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location20889716-20890651 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 20890483 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 57 (I57V)
Ref Sequence ENSEMBL: ENSMUSP00000056228 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061278]
Predicted Effect possibly damaging
Transcript: ENSMUST00000061278
AA Change: I57V

PolyPhen 2 Score 0.461 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000056228
Gene: ENSMUSG00000050933
AA Change: I57V

DomainStartEndE-ValueType
Pfam:TAS2R 6 294 1.6e-13 PFAM
Pfam:V1R 36 297 1.6e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232004
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 100% (38/38)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahcyl1 C T 3: 107,675,085 G54D probably damaging Het
Aldh1b1 T C 4: 45,803,427 C322R probably damaging Het
Cdc14b T C 13: 64,215,563 I258V probably damaging Het
Cenph T C 13: 100,772,735 I55V probably benign Het
Cep290 T A 10: 100,569,144 probably null Het
Ces2b A G 8: 104,837,287 Y431C probably damaging Het
Cyp4f17 T C 17: 32,506,976 S28P possibly damaging Het
Cyp4f40 C G 17: 32,675,742 T427S possibly damaging Het
Exoc2 A G 13: 30,935,507 I137T probably benign Het
Fam168b C A 1: 34,836,741 G21V probably damaging Het
G3bp1 T A 11: 55,493,509 D168E probably benign Het
Gm765 T G 6: 98,248,208 H38P possibly damaging Het
Impg2 T A 16: 56,252,333 L376H probably damaging Het
Kdm4d A T 9: 14,463,065 M499K probably benign Het
Lonp1 C T 17: 56,619,230 V426M probably damaging Het
Lypla2 C A 4: 135,970,862 A26S probably benign Het
Map3k13 T C 16: 21,905,237 V323A possibly damaging Het
Mov10 A G 3: 104,818,044 L83P probably damaging Het
Mphosph9 G T 5: 124,260,116 A1039D probably damaging Het
Nedd1 T C 10: 92,698,337 K317R possibly damaging Het
Olfr1117-ps1 A G 2: 87,308,992 T68A possibly damaging Het
Pde3a T A 6: 141,479,346 S623T probably damaging Het
Pld1 T A 3: 28,041,199 M227K probably benign Het
Rell1 T G 5: 63,937,867 K85N probably damaging Het
Rhbdf1 T C 11: 32,215,652 T93A probably damaging Het
Sccpdh T A 1: 179,684,227 M88K possibly damaging Het
Siae T G 9: 37,642,799 probably null Het
Slc22a16 G A 10: 40,603,905 E637K unknown Het
Stk19 C T 17: 34,824,794 G95S probably benign Het
Stpg2 G A 3: 139,522,977 probably null Het
Sult2a5 T A 7: 13,624,132 F30I probably damaging Het
Svil A G 18: 5,082,853 E748G probably damaging Het
Swap70 T A 7: 110,269,919 H306Q probably benign Het
Try10 G A 6: 41,357,821 G227D probably damaging Het
Ttn T C 2: 76,896,369 probably benign Het
Ttn T A 2: 76,919,092 H3871L probably benign Het
Vpreb1 A G 16: 16,868,802 S75P probably damaging Het
Zkscan5 A G 5: 145,221,084 probably null Het
Other mutations in Vmn1r231
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Vmn1r231 APN 17 20890566 missense possibly damaging 0.68
IGL02124:Vmn1r231 APN 17 20890306 missense probably damaging 1.00
IGL02151:Vmn1r231 APN 17 20889735 missense probably benign 0.06
R0066:Vmn1r231 UTSW 17 20889736 missense probably benign 0.27
R0066:Vmn1r231 UTSW 17 20889736 missense probably benign 0.27
R0396:Vmn1r231 UTSW 17 20890399 missense probably damaging 0.98
R0427:Vmn1r231 UTSW 17 20890228 missense probably benign 0.05
R0470:Vmn1r231 UTSW 17 20890003 nonsense probably null
R0848:Vmn1r231 UTSW 17 20890171 missense probably damaging 1.00
R1692:Vmn1r231 UTSW 17 20890609 missense probably benign 0.02
R1987:Vmn1r231 UTSW 17 20889950 missense probably damaging 1.00
R1988:Vmn1r231 UTSW 17 20889950 missense probably damaging 1.00
R2105:Vmn1r231 UTSW 17 20890118 missense possibly damaging 0.66
R4440:Vmn1r231 UTSW 17 20890456 missense possibly damaging 0.48
R4634:Vmn1r231 UTSW 17 20890398 missense possibly damaging 0.46
R4646:Vmn1r231 UTSW 17 20890309 missense probably damaging 1.00
R4678:Vmn1r231 UTSW 17 20890227 missense possibly damaging 0.94
R4696:Vmn1r231 UTSW 17 20890639 missense possibly damaging 0.63
R4938:Vmn1r231 UTSW 17 20890351 missense possibly damaging 0.76
R5544:Vmn1r231 UTSW 17 20890578 missense probably damaging 1.00
R5942:Vmn1r231 UTSW 17 20890155 missense possibly damaging 0.83
R6053:Vmn1r231 UTSW 17 20889819 missense probably damaging 1.00
R6712:Vmn1r231 UTSW 17 20889730 missense possibly damaging 0.54
R7131:Vmn1r231 UTSW 17 20889878 missense possibly damaging 0.87
R7854:Vmn1r231 UTSW 17 20890632 missense probably damaging 0.98
R7937:Vmn1r231 UTSW 17 20890632 missense probably damaging 0.98
RF010:Vmn1r231 UTSW 17 20889993 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATGGCCTGGAAGACACTCAAG -3'
(R):5'- TCCACTGCCTAATGGTAAAACATC -3'

Sequencing Primer
(F):5'- CACTCAAGAGACAGATGGTACCAATG -3'
(R):5'- ACATCATTTTGGTCAGAGAAGTG -3'
Posted On2018-07-23