Incidental Mutation 'R6692:Cyp4f17'
ID527931
Institutional Source Beutler Lab
Gene Symbol Cyp4f17
Ensembl Gene ENSMUSG00000091586
Gene Namecytochrome P450, family 4, subfamily f, polypeptide 17
SynonymsEG208285
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R6692 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location32506462-32528894 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 32506976 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 28 (S28P)
Ref Sequence ENSEMBL: ENSMUSP00000129514 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165999]
Predicted Effect possibly damaging
Transcript: ENSMUST00000165999
AA Change: S28P

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000129514
Gene: ENSMUSG00000091586
AA Change: S28P

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:p450 52 515 3.5e-135 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 100% (38/38)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahcyl1 C T 3: 107,675,085 G54D probably damaging Het
Aldh1b1 T C 4: 45,803,427 C322R probably damaging Het
Cdc14b T C 13: 64,215,563 I258V probably damaging Het
Cenph T C 13: 100,772,735 I55V probably benign Het
Cep290 T A 10: 100,569,144 probably null Het
Ces2b A G 8: 104,837,287 Y431C probably damaging Het
Cyp4f40 C G 17: 32,675,742 T427S possibly damaging Het
Exoc2 A G 13: 30,935,507 I137T probably benign Het
Fam168b C A 1: 34,836,741 G21V probably damaging Het
G3bp1 T A 11: 55,493,509 D168E probably benign Het
Gm765 T G 6: 98,248,208 H38P possibly damaging Het
Impg2 T A 16: 56,252,333 L376H probably damaging Het
Kdm4d A T 9: 14,463,065 M499K probably benign Het
Lonp1 C T 17: 56,619,230 V426M probably damaging Het
Lypla2 C A 4: 135,970,862 A26S probably benign Het
Map3k13 T C 16: 21,905,237 V323A possibly damaging Het
Mov10 A G 3: 104,818,044 L83P probably damaging Het
Mphosph9 G T 5: 124,260,116 A1039D probably damaging Het
Nedd1 T C 10: 92,698,337 K317R possibly damaging Het
Olfr1117-ps1 A G 2: 87,308,992 T68A possibly damaging Het
Pde3a T A 6: 141,479,346 S623T probably damaging Het
Pld1 T A 3: 28,041,199 M227K probably benign Het
Rell1 T G 5: 63,937,867 K85N probably damaging Het
Rhbdf1 T C 11: 32,215,652 T93A probably damaging Het
Sccpdh T A 1: 179,684,227 M88K possibly damaging Het
Siae T G 9: 37,642,799 probably null Het
Slc22a16 G A 10: 40,603,905 E637K unknown Het
Stk19 C T 17: 34,824,794 G95S probably benign Het
Stpg2 G A 3: 139,522,977 probably null Het
Sult2a5 T A 7: 13,624,132 F30I probably damaging Het
Svil A G 18: 5,082,853 E748G probably damaging Het
Swap70 T A 7: 110,269,919 H306Q probably benign Het
Try10 G A 6: 41,357,821 G227D probably damaging Het
Ttn T C 2: 76,896,369 probably benign Het
Ttn T A 2: 76,919,092 H3871L probably benign Het
Vmn1r231 T C 17: 20,890,483 I57V possibly damaging Het
Vpreb1 A G 16: 16,868,802 S75P probably damaging Het
Zkscan5 A G 5: 145,221,084 probably null Het
Other mutations in Cyp4f17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00580:Cyp4f17 APN 17 32524875 nonsense probably null
IGL01767:Cyp4f17 APN 17 32506982 missense probably benign
IGL01867:Cyp4f17 APN 17 32528083 missense probably benign 0.30
IGL02009:Cyp4f17 APN 17 32524880 missense probably damaging 1.00
IGL02423:Cyp4f17 APN 17 32506949 missense possibly damaging 0.93
IGL02503:Cyp4f17 APN 17 32524966 critical splice donor site probably null
IGL02571:Cyp4f17 APN 17 32524904 missense probably benign 0.42
IGL03328:Cyp4f17 APN 17 32520626 missense probably damaging 1.00
IGL03047:Cyp4f17 UTSW 17 32524049 missense possibly damaging 0.88
PIT4810001:Cyp4f17 UTSW 17 32524600 missense possibly damaging 0.56
R0486:Cyp4f17 UTSW 17 32524823 splice site probably benign
R0606:Cyp4f17 UTSW 17 32527843 missense probably damaging 0.98
R0655:Cyp4f17 UTSW 17 32524897 missense possibly damaging 0.95
R1781:Cyp4f17 UTSW 17 32524019 missense possibly damaging 0.94
R1795:Cyp4f17 UTSW 17 32517969 missense probably benign 0.00
R1833:Cyp4f17 UTSW 17 32524210 missense probably benign 0.01
R2268:Cyp4f17 UTSW 17 32517954 missense probably benign 0.44
R3030:Cyp4f17 UTSW 17 32506976 missense possibly damaging 0.93
R3861:Cyp4f17 UTSW 17 32528104 missense probably damaging 0.97
R5236:Cyp4f17 UTSW 17 32520632 critical splice donor site probably null
R5450:Cyp4f17 UTSW 17 32528886 missense probably benign
R5866:Cyp4f17 UTSW 17 32506913 missense probably benign 0.03
R5886:Cyp4f17 UTSW 17 32524039 missense possibly damaging 0.78
R5965:Cyp4f17 UTSW 17 32524637 missense probably damaging 0.99
R7056:Cyp4f17 UTSW 17 32527872 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GTCACCATCTCTGTCCAGTG -3'
(R):5'- TGCCGGGTATGTGACTAGATAG -3'

Sequencing Primer
(F):5'- ATCTCTGTCCAGTGACCATGGAG -3'
(R):5'- CCGGGTATGTGACTAGATAGAGACTC -3'
Posted On2018-07-23