Incidental Mutation 'R6295:Ibsp'
List |< first << previous [record 23 of 51] next >> last >|
ID527941
Institutional Source Beutler Lab
Gene Symbol Ibsp
Ensembl Gene ENSMUSG00000029306
Gene Nameintegrin binding sialoprotein
SynonymsBsp2, bone sialoprotein, BSP
MMRRC Submission
Accession Numbers

Genbank: NM_008318.3

Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R6295 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location104299171-104311469 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to A at 104302121 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000031246 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031246]
Predicted Effect probably null
Transcript: ENSMUST00000031246
SMART Domains Protein: ENSMUSP00000031246
Gene: ENSMUSG00000029306

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:BSP_II 17 321 2.8e-127 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177797
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a major structural protein of the bone matrix. It constitutes approximately 12% of the noncollagenous proteins in human bone and is synthesized by skeletal-associated cell types, including hypertrophic chondrocytes, osteoblasts, osteocytes, and osteoclasts. The only extraskeletal site of its synthesis is the trophoblast. This protein binds to calcium and hydroxyapatite via its acidic amino acid clusters, and mediates cell attachment through an RGD sequence that recognizes the vitronectin receptor. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele show reduced body weight/size, delayed long bone growth and mineralization with low bone turn over due to reduced osteoclast formation, delayed intramembranous ossification, progressive periodontal breakdown, and severe alveolar and mandibular bone loss. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Targeted, other(2)

Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 A C 12: 118,874,644 V1061G probably damaging Het
Acap1 A G 11: 69,890,587 probably null Het
Apbb1 A G 7: 105,566,695 F112L probably benign Het
Atg9a A G 1: 75,185,058 S615P probably benign Het
Atp8a2 G A 14: 60,012,399 R548* probably null Het
Bbof1 A T 12: 84,411,168 N69I possibly damaging Het
Bcl2l14 T A 6: 134,427,407 V186D probably benign Het
Bmp1 T G 14: 70,491,383 Y583S possibly damaging Het
Boc A C 16: 44,492,348 S586R probably benign Het
Btbd9 A T 17: 30,299,736 probably null Het
Cacna1e T C 1: 154,442,173 M1180V probably damaging Het
Ciao1 T C 2: 127,246,456 H149R probably damaging Het
Cops5 T C 1: 10,030,695 probably benign Het
Doc2b T C 11: 75,795,625 Y90C probably benign Het
Doc2b C T 11: 75,780,267 R209Q probably damaging Het
Ep400 A G 5: 110,753,809 F481L probably benign Het
Fat4 T A 3: 39,007,080 probably null Het
Fbxw16 T A 9: 109,448,769 probably benign Het
Fbxw27 T C 9: 109,772,086 E17G possibly damaging Het
Gm29735 G A 7: 142,156,630 P162S unknown Het
Gypa T G 8: 80,496,340 S24R unknown Het
Hdhd5 T C 6: 120,518,524 N153D probably benign Het
Klhdc3 C T 17: 46,678,046 V73I probably benign Het
Lrrc37a T C 11: 103,497,633 E2322G unknown Het
Lrrtm3 T C 10: 63,930,134 H558R probably benign Het
Mbtd1 C T 11: 93,932,232 H493Y possibly damaging Het
Mphosph9 A G 5: 124,320,915 V64A possibly damaging Het
Nthl1 C T 17: 24,638,501 R251C probably damaging Het
Numa1 G A 7: 102,000,767 R1235H probably benign Het
Olfr512 T C 7: 108,713,638 V95A probably damaging Het
Opn1sw T A 6: 29,379,414 Y197F possibly damaging Het
Pcca A T 14: 122,658,775 I268F probably benign Het
Per2 A T 1: 91,449,872 D76E unknown Het
Pfas T C 11: 68,997,999 N374S probably benign Het
Pomk C A 8: 25,982,927 V333F probably damaging Het
Ptgfr T C 3: 151,835,289 E194G probably benign Het
Ptpn14 C T 1: 189,850,800 P615S probably damaging Het
Pyroxd1 T C 6: 142,354,753 I203T probably benign Het
Rgs22 T C 15: 36,087,374 N466S probably benign Het
Rpl3l G A 17: 24,733,992 V309I probably benign Het
Rtkn2 C T 10: 67,979,699 probably benign Het
Sec16a C T 2: 26,428,241 A1613T probably damaging Het
Sis T A 3: 72,966,770 T33S probably damaging Het
Slc22a4 C A 11: 54,007,808 V153F possibly damaging Het
Stxbp1 C G 2: 32,794,609 E603Q probably damaging Het
Tiam2 A G 17: 3,509,556 S1291G probably damaging Het
Tmem94 T A 11: 115,796,746 L1144M probably damaging Het
Ttn G A 2: 76,749,329 T23740M probably damaging Het
Vmn1r201 T C 13: 22,475,363 V249A probably benign Het
Wdr7 T A 18: 63,755,111 C552S probably damaging Het
Other mutations in Ibsp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00687:Ibsp APN 5 104310068 missense probably benign 0.27
IGL02317:Ibsp APN 5 104302466 missense probably damaging 1.00
IGL02539:Ibsp APN 5 104302283 missense probably damaging 0.99
IGL03236:Ibsp APN 5 104306005 missense probably benign 0.30
crunch UTSW 5 104309282 missense probably damaging 1.00
I2289:Ibsp UTSW 5 104302487 missense possibly damaging 0.64
PIT4445001:Ibsp UTSW 5 104302304 missense possibly damaging 0.94
R0049:Ibsp UTSW 5 104302158 missense probably damaging 1.00
R0049:Ibsp UTSW 5 104302158 missense probably damaging 1.00
R0234:Ibsp UTSW 5 104310069 small deletion probably benign
R0610:Ibsp UTSW 5 104310134 missense probably benign 0.07
R0656:Ibsp UTSW 5 104310020 critical splice acceptor site probably null
R1168:Ibsp UTSW 5 104302152 missense probably damaging 0.99
R1440:Ibsp UTSW 5 104310539 missense unknown
R1569:Ibsp UTSW 5 104310151 missense probably damaging 1.00
R1921:Ibsp UTSW 5 104310212 missense probably damaging 1.00
R2172:Ibsp UTSW 5 104310430 missense probably damaging 1.00
R2879:Ibsp UTSW 5 104310394 missense possibly damaging 0.88
R4399:Ibsp UTSW 5 104309282 missense probably damaging 1.00
R4517:Ibsp UTSW 5 104305997 nonsense probably null
R5417:Ibsp UTSW 5 104310469 missense possibly damaging 0.95
R5575:Ibsp UTSW 5 104310059 missense possibly damaging 0.78
R6183:Ibsp UTSW 5 104306030 missense possibly damaging 0.95
R6273:Ibsp UTSW 5 104310301 missense probably benign 0.15
R7061:Ibsp UTSW 5 104309902 intron probably null
R7133:Ibsp UTSW 5 104302306 nonsense probably null
R7202:Ibsp UTSW 5 104302161 missense probably benign 0.02
R7205:Ibsp UTSW 5 104310431 missense probably damaging 0.99
R7769:Ibsp UTSW 5 104306005 missense probably benign 0.15
R7769:Ibsp UTSW 5 104310184 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CAGAGCTTTTCAGGACTAGGG -3'
(R):5'- AATGGTCTGAAATCAGTTACCCCG -3'

Sequencing Primer
(F):5'- CTTTTCAGGACTAGGGGTCAAACAC -3'
(R):5'- GAAATCAGTTACCCCGTTTTCTTCAG -3'
Posted On2018-07-23