Incidental Mutation 'R6248:Krit1'
ID527952
Institutional Source Beutler Lab
Gene Symbol Krit1
Ensembl Gene ENSMUSG00000000600
Gene NameKRIT1, ankyrin repeat containing
SynonymsKrit1B, A630036P20Rik, Krit1, Krit1A, Ccm1, 2010007K12Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6248 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location3803184-3845564 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to G at 3813032 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000132375 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080085] [ENSMUST00000171023] [ENSMUST00000198079] [ENSMUST00000200386] [ENSMUST00000200577]
Predicted Effect probably null
Transcript: ENSMUST00000080085
SMART Domains Protein: ENSMUSP00000078985
Gene: ENSMUSG00000000600

DomainStartEndE-ValueType
Pfam:NUDIX_5 22 198 3.8e-88 PFAM
ANK 287 316 1.04e2 SMART
ANK 320 350 4.5e-3 SMART
ANK 354 382 1.17e-1 SMART
B41 416 640 1.39e-39 SMART
Blast:B41 673 702 6e-8 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000171023
SMART Domains Protein: ENSMUSP00000132375
Gene: ENSMUSG00000000600

DomainStartEndE-ValueType
PDB:4DX8|K 1 198 1e-125 PDB
ANK 287 316 1.04e2 SMART
ANK 320 350 4.5e-3 SMART
ANK 354 382 1.17e-1 SMART
B41 416 640 1.39e-39 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196098
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197611
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197742
Predicted Effect probably benign
Transcript: ENSMUST00000198079
SMART Domains Protein: ENSMUSP00000142657
Gene: ENSMUSG00000000600

DomainStartEndE-ValueType
PDB:4DX8|K 20 132 4e-62 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199475
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199845
Predicted Effect probably benign
Transcript: ENSMUST00000200386
SMART Domains Protein: ENSMUSP00000143559
Gene: ENSMUSG00000000600

DomainStartEndE-ValueType
Pfam:NUDIX_5 22 198 8.1e-85 PFAM
ANK 306 334 7.5e-4 SMART
B41 368 592 9.1e-42 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000200577
SMART Domains Protein: ENSMUSP00000143776
Gene: ENSMUSG00000000600

DomainStartEndE-ValueType
Pfam:NUDIX_5 22 198 1.8e-85 PFAM
Blast:B41 200 329 1e-82 BLAST
SCOP:d1ycsb1 291 329 2e-8 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.2%
Validation Efficiency 100% (92/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing four ankyrin repeats, a band 4.1/ezrin/radixin/moesin (FERM) domain, and multiple NPXY sequences. The encoded protein is localized in the nucleus and cytoplasm. It binds to integrin cytoplasmic domain-associated protein-1 alpha (ICAP1alpha), and plays a critical role in beta1-integrin-mediated cell proliferation. It associates with junction proteins and RAS-related protein 1A (Rap1A), which requires the encoded protein for maintaining the integrity of endothelial junctions. It is also a microtubule-associated protein and may play a role in microtubule targeting. Mutations in this gene result in cerebral cavernous malformations. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2009]
PHENOTYPE: Targeted disruption of this gene results in embryonic lethality by E11. Embryos display prominent vascular defects that disrupt arterial modeling and phenocopy the human disorder of cerebral cavernous malformations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930523C07Rik T C 1: 160,075,408 S83P possibly damaging Het
Actr10 A T 12: 70,952,959 E176D probably benign Het
Adcy3 G A 12: 4,208,662 probably null Het
AI429214 T A 8: 36,994,124 I142N probably damaging Het
Alox12 A G 11: 70,253,110 L148S probably damaging Het
Ank3 A G 10: 69,973,850 I1147V probably benign Het
Apoc2 C T 7: 19,673,568 V12I probably benign Het
Arap3 T C 18: 37,991,354 S311G probably benign Het
Arih2 G T 9: 108,611,642 H292Q probably damaging Het
Cdc14a A T 3: 116,308,194 D312E probably benign Het
Cdh12 T G 15: 21,237,714 W12G possibly damaging Het
Cisd2 A T 3: 135,408,855 N118K probably damaging Het
Cntnap5b A G 1: 100,072,102 Q195R probably benign Het
Cyp2r1 A G 7: 114,562,731 probably null Het
Cyp4f37 A G 17: 32,629,890 D244G possibly damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dido1 T A 2: 180,660,255 H1952L probably damaging Het
Dnah10 T A 5: 124,794,219 probably null Het
Dnal4 T A 15: 79,762,513 M56L probably damaging Het
Emilin2 A G 17: 71,274,117 V538A probably benign Het
Eps8l2 A G 7: 141,342,102 D31G probably damaging Het
Erp44 A T 4: 48,219,479 L112* probably null Het
Etl4 C T 2: 20,809,089 T1907I possibly damaging Het
Exoc3 A G 13: 74,182,281 F510L probably benign Het
Fam114a2 G T 11: 57,493,116 T324K possibly damaging Het
Fer1l4 G A 2: 156,046,171 R465C probably damaging Het
Frmd4b A C 6: 97,459,212 S2R probably benign Het
Fscn1 A T 5: 142,961,023 D192V possibly damaging Het
Gm15922 C A 7: 3,736,338 E510D probably benign Het
Gm3486 T A 14: 41,484,515 *200C probably null Het
Gusb A T 5: 130,000,525 H138Q probably benign Het
Hdac9 A T 12: 34,528,294 M4K possibly damaging Het
Hhipl1 G T 12: 108,318,705 R439L probably benign Het
Hoxd9 A G 2: 74,698,636 E194G probably benign Het
Itgb1 A G 8: 128,722,421 S503G possibly damaging Het
Kcnt2 T A 1: 140,509,478 C500S probably damaging Het
Kdm7a G A 6: 39,147,049 S727L possibly damaging Het
Klhdc4 A G 8: 121,813,768 F92L probably damaging Het
Klrb1a A G 6: 128,619,174 V62A probably damaging Het
Krt40 A G 11: 99,541,740 I150T possibly damaging Het
Larp4b A G 13: 9,158,702 T464A probably benign Het
Lrrc52 T G 1: 167,466,395 D107A probably damaging Het
Mapkap1 G T 2: 34,518,680 V35F probably damaging Het
Mccc1 A G 3: 35,990,164 V171A probably damaging Het
Metap1d A T 2: 71,515,760 R222* probably null Het
Mrgpre G A 7: 143,780,866 A300V probably benign Het
Mterf1b C A 5: 4,196,606 N82K probably benign Het
Myh9 C T 15: 77,785,222 W533* probably null Het
Myom2 A G 8: 15,098,472 probably null Het
Ncor1 G A 11: 62,366,982 P329S probably damaging Het
Nr2f1 T C 13: 78,196,492 probably benign Het
Olfr1348 A T 7: 6,501,676 C183* probably null Het
Olfr1361 A T 13: 21,659,074 I83N possibly damaging Het
Olfr417 T G 1: 174,369,670 V251G probably benign Het
Olfr47 C T 6: 43,235,904 Q99* probably null Het
Olfr551 T C 7: 102,588,030 T238A probably benign Het
Olfr800 A G 10: 129,660,663 I286V probably benign Het
Olfr96 T A 17: 37,225,560 L145* probably null Het
Pcdha11 T C 18: 37,005,897 L193P probably benign Het
Pcdhb20 T A 18: 37,506,232 F604I probably damaging Het
Pde1a T C 2: 79,878,201 H291R probably damaging Het
Pfkm G A 15: 98,126,379 V423M probably damaging Het
Pkd2l1 G T 19: 44,157,669 Q149K probably benign Het
Pkhd1l1 T A 15: 44,529,559 N1763K probably benign Het
Pla2g4a G A 1: 149,872,587 T282I probably damaging Het
Prpf39 A C 12: 65,042,754 N89H probably damaging Het
Rad54l2 A G 9: 106,710,338 F743L probably damaging Het
Raver2 A G 4: 101,134,123 probably null Het
Ric8b T C 10: 84,947,845 L189P probably damaging Het
Sccpdh T C 1: 179,668,392 F13L probably benign Het
Scd2 T C 19: 44,303,009 F296L probably damaging Het
Scg2 G T 1: 79,436,306 D233E probably benign Het
Sema5b C A 16: 35,628,007 probably null Het
Skint5 A T 4: 113,779,089 V644E unknown Het
Slc44a5 G T 3: 154,264,041 V612F possibly damaging Het
Snd1 C T 6: 28,520,235 R107* probably null Het
Sun5 G T 2: 153,860,669 T189K probably damaging Het
Tap1 A T 17: 34,193,177 E452V probably damaging Het
Tcam1 A G 11: 106,282,826 N32S probably benign Het
Tep1 T C 14: 50,830,258 E2167G probably damaging Het
Tm9sf1 C T 14: 55,636,370 R557H probably damaging Het
Tmem175 T C 5: 108,645,955 V317A probably damaging Het
Tsga13 A G 6: 30,897,204 V231A probably benign Het
Tspan12 A G 6: 21,799,971 S126P probably damaging Het
Uvrag G T 7: 98,988,191 D143E probably damaging Het
Vmn1r230 T A 17: 20,846,774 M75K possibly damaging Het
Vmn2r120 A T 17: 57,545,287 F10I probably benign Het
Vmn2r57 T C 7: 41,399,860 T822A probably benign Het
Vmn2r67 T C 7: 85,150,560 Y490C probably damaging Het
Zc3h7b T A 15: 81,783,185 W644R probably damaging Het
Zeb1 A G 18: 5,766,962 D491G probably damaging Het
Zfp709 TCGACG TCG 8: 71,890,708 probably benign Het
Zfp831 A T 2: 174,644,515 T328S possibly damaging Het
Other mutations in Krit1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01088:Krit1 APN 5 3812844 missense probably damaging 0.98
IGL02186:Krit1 APN 5 3809733 splice site probably benign
IGL02526:Krit1 APN 5 3822103 missense probably damaging 1.00
IGL03280:Krit1 APN 5 3811248 splice site probably benign
IGL03385:Krit1 APN 5 3807452 missense possibly damaging 0.51
Waspish UTSW 5 3831551 missense probably damaging 1.00
R0127:Krit1 UTSW 5 3822178 missense probably damaging 0.99
R0594:Krit1 UTSW 5 3823694 missense possibly damaging 0.71
R1157:Krit1 UTSW 5 3832176 missense probably damaging 1.00
R1777:Krit1 UTSW 5 3836799 missense probably damaging 0.96
R2115:Krit1 UTSW 5 3822108 nonsense probably null
R4021:Krit1 UTSW 5 3832132 missense probably benign 0.21
R4041:Krit1 UTSW 5 3809642 missense probably damaging 1.00
R4786:Krit1 UTSW 5 3812467 missense possibly damaging 0.86
R4989:Krit1 UTSW 5 3822238 missense probably damaging 1.00
R5217:Krit1 UTSW 5 3806451 nonsense probably null
R5304:Krit1 UTSW 5 3819326 missense probably damaging 0.99
R5371:Krit1 UTSW 5 3831551 missense probably damaging 1.00
R5682:Krit1 UTSW 5 3830737 missense probably damaging 0.99
R6338:Krit1 UTSW 5 3836857 missense probably benign 0.01
R7081:Krit1 UTSW 5 3823651 missense possibly damaging 0.71
R7454:Krit1 UTSW 5 3812474 missense probably damaging 0.99
R7497:Krit1 UTSW 5 3812349 missense possibly damaging 0.93
R7684:Krit1 UTSW 5 3830723 missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- GCGTTGTGGAAGACAAGTAC -3'
(R):5'- CAGATGCTTTCTGGAATGAGAACAG -3'

Sequencing Primer
(F):5'- TGTGGAAGACAAGTACAGTTTTG -3'
(R):5'- GCTTTCTGGAATGAGAACAGTTTTC -3'
Posted On2018-07-23