Incidental Mutation 'R6265:Lair1'
ID527955
Institutional Source Beutler Lab
Gene Symbol Lair1
Ensembl Gene ENSMUSG00000055541
Gene Nameleukocyte-associated Ig-like receptor 1
SynonymsmLair-1, Lair-1, 5133400O11Rik, D7Bwg0421e
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6265 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location4003402-4063204 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to A at 4055827 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000145940 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068865] [ENSMUST00000086400] [ENSMUST00000086401] [ENSMUST00000108600] [ENSMUST00000131126] [ENSMUST00000136616] [ENSMUST00000149395] [ENSMUST00000205296]
Predicted Effect probably benign
Transcript: ENSMUST00000068865
SMART Domains Protein: ENSMUSP00000070712
Gene: ENSMUSG00000055541

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
transmembrane domain 33 55 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000086400
SMART Domains Protein: ENSMUSP00000083588
Gene: ENSMUSG00000055541

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
PDB:4ETY|D 22 134 5e-79 PDB
SCOP:d1nkr_2 24 118 2e-9 SMART
Blast:IG 38 119 9e-27 BLAST
transmembrane domain 143 165 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000086401
SMART Domains Protein: ENSMUSP00000083589
Gene: ENSMUSG00000055541

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
PDB:4ETY|D 22 134 1e-78 PDB
SCOP:d1nkr_2 24 118 2e-9 SMART
Blast:IG 38 119 2e-26 BLAST
transmembrane domain 143 165 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108600
SMART Domains Protein: ENSMUSP00000104241
Gene: ENSMUSG00000055541

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
PDB:4ETY|D 22 133 8e-79 PDB
SCOP:d1nkr_2 24 118 1e-9 SMART
Blast:IG 38 119 6e-27 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000119711
SMART Domains Protein: ENSMUSP00000113871
Gene: ENSMUSG00000055541

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
PDB:4ETY|D 22 133 4e-79 PDB
SCOP:d1nkr_2 24 118 7e-9 SMART
Blast:IG 38 119 2e-27 BLAST
Predicted Effect unknown
Transcript: ENSMUST00000131126
AA Change: Y54F
SMART Domains Protein: ENSMUSP00000121738
Gene: ENSMUSG00000055541
AA Change: Y54F

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000136616
AA Change: Y54F
SMART Domains Protein: ENSMUSP00000122037
Gene: ENSMUSG00000055541
AA Change: Y54F

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000149395
AA Change: Y54F
SMART Domains Protein: ENSMUSP00000116800
Gene: ENSMUSG00000055541
AA Change: Y54F

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205296
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an inhibitory receptor found on peripheral mononuclear cells, including natural killer cells, T cells, and B cells. Inhibitory receptors regulate the immune response to prevent lysis of cells recognized as self. The gene is a member of both the immunoglobulin superfamily and the leukocyte-associated inhibitory receptor family. The gene maps to a region of 19q13.4 called the leukocyte receptor cluster, which contains at least 29 genes encoding leukocyte-expressed receptors of the immunoglobulin superfamily. The encoded protein has been identified as an anchor for tyrosine phosphatase SHP-1, and may induce cell death in myeloid leukemias. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a knock-out allele are healthy and of normal longevity but show increased numbers of splenic B, regulatory T, and dendritic cells, and eosinophilia at a young age. Aging homozygotes display a higher frequency of activated and effector/memory T cells and a decreased IgG1 level. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik C T 4: 137,454,675 P47L probably damaging Het
Acot1 T C 12: 84,016,913 I265T probably benign Het
Amotl1 T C 9: 14,571,655 D587G possibly damaging Het
Anks1b T G 10: 90,941,500 D1117E probably damaging Het
Art4 T G 6: 136,854,888 N85T probably damaging Het
Asb3 C A 11: 31,085,143 Q462K probably benign Het
Atcay C T 10: 81,213,280 E163K possibly damaging Het
Atp6v0e T C 17: 26,676,533 V20A possibly damaging Het
Atp7b G A 8: 22,015,927 Q520* probably null Het
Baat A T 4: 49,502,836 D95E possibly damaging Het
Cars2 TCCCC TCCC 8: 11,529,599 probably null Het
Ccdc24 G A 4: 117,871,177 Q47* probably null Het
Cep170b C A 12: 112,744,559 Q1488K probably damaging Het
Cldn24 A C 8: 47,822,339 D66A probably benign Het
Cln5 C A 14: 103,073,227 T110K probably damaging Het
Clvs2 C A 10: 33,528,515 S235I possibly damaging Het
Col5a3 C T 9: 20,793,764 G730R unknown Het
Crim1 C T 17: 78,370,085 P905L probably benign Het
Cxxc4 T C 3: 134,258,063 V356A probably benign Het
Dctn6 G T 8: 34,094,903 N93K probably damaging Het
Dnah9 G A 11: 66,168,094 A125V probably benign Het
Dnhd1 T C 7: 105,693,370 I1307T probably benign Het
Dpy19l1 T A 9: 24,432,371 I493F possibly damaging Het
Ebf2 A G 14: 67,424,060 I546V probably benign Het
Fbll1 T C 11: 35,797,809 E209G probably damaging Het
Foxj2 G A 6: 122,828,174 A2T probably damaging Het
Foxs1 A T 2: 152,932,178 C318* probably null Het
Gorab T C 1: 163,386,630 T244A possibly damaging Het
Gtsf1l C A 2: 163,087,663 probably benign Het
Herc1 T C 9: 66,372,016 S69P probably benign Het
Hpca C T 4: 129,118,652 W30* probably null Het
Ing3 C A 6: 21,953,814 Q85K probably damaging Het
Klhdc8b T C 9: 108,448,425 E264G probably damaging Het
Lama1 T C 17: 67,750,655 Y575H probably damaging Het
Lamtor2 C A 3: 88,550,713 G29* probably null Het
Loxhd1 A T 18: 77,361,730 D341V probably damaging Het
Lrp2 T A 2: 69,466,340 D3290V probably damaging Het
Matn2 A T 15: 34,399,155 D396V probably damaging Het
Me3 T A 7: 89,849,743 D510E probably benign Het
Melk A G 4: 44,318,109 Y170C probably damaging Het
Mgat2 T C 12: 69,184,793 V47A probably benign Het
Mindy4 T C 6: 55,301,064 I631T probably damaging Het
Myo5b T A 18: 74,577,440 probably null Het
Myo7b A T 18: 31,998,150 D521E probably damaging Het
Nlrp9b T A 7: 20,062,683 F986I probably benign Het
Olfr1089 A G 2: 86,732,955 L219P probably damaging Het
Patj A G 4: 98,469,567 D690G probably benign Het
Pias2 T C 18: 77,097,258 S5P probably damaging Het
Reep4 A T 14: 70,547,703 S150C probably damaging Het
Slc25a21 T C 12: 57,196,900 R14G probably benign Het
Slc6a6 G C 6: 91,754,915 R575T probably damaging Het
Speg T A 1: 75,406,679 Y886* probably null Het
Tas2r103 A C 6: 133,036,531 F191V probably damaging Het
Tbc1d19 A G 5: 53,837,924 D145G probably benign Het
Tex47 T A 5: 7,305,461 I214N probably damaging Het
Tnnt3 A T 7: 142,501,645 D3V probably damaging Het
Trdv2-1 T G 14: 53,946,385 S24A probably benign Het
Ubr4 A G 4: 139,452,640 D3377G possibly damaging Het
Ugt3a2 A T 15: 9,361,579 D147V probably damaging Het
Usp9y A T Y: 1,446,843 D103E probably benign Homo
Vmn1r168 A G 7: 23,541,536 I273V probably benign Het
Vmn2r61 T C 7: 42,266,491 I176T probably benign Het
Vmn2r8 T A 5: 108,808,597 D53V probably benign Het
Zbtb8os A T 4: 129,335,982 probably benign Het
Zfp551 C T 7: 12,415,412 R690Q probably damaging Het
Other mutations in Lair1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00672:Lair1 APN 7 4028731 missense probably benign 0.01
IGL01475:Lair1 APN 7 4009684 utr 3 prime probably benign
IGL02696:Lair1 APN 7 4010849 intron probably benign
IGL02749:Lair1 APN 7 4028901 missense possibly damaging 0.50
R0396:Lair1 UTSW 7 4010786 missense probably damaging 1.00
R0703:Lair1 UTSW 7 4010760 missense probably null 0.99
R1053:Lair1 UTSW 7 4028785 missense probably damaging 1.00
R1332:Lair1 UTSW 7 4010596 missense possibly damaging 0.77
R1717:Lair1 UTSW 7 4010789 missense probably damaging 1.00
R2022:Lair1 UTSW 7 4063064 splice site probably null
R2509:Lair1 UTSW 7 4010783 missense probably damaging 1.00
R3721:Lair1 UTSW 7 4010783 missense probably damaging 1.00
R4021:Lair1 UTSW 7 4055916 critical splice donor site probably null
R4784:Lair1 UTSW 7 4009732 missense probably benign 0.15
R4873:Lair1 UTSW 7 4029034 missense probably benign 0.05
R4875:Lair1 UTSW 7 4029034 missense probably benign 0.05
R4940:Lair1 UTSW 7 4028949 missense probably benign 0.00
R5125:Lair1 UTSW 7 4010489 missense possibly damaging 0.92
R5178:Lair1 UTSW 7 4010489 missense possibly damaging 0.92
R5888:Lair1 UTSW 7 4010845 missense probably damaging 0.96
R5965:Lair1 UTSW 7 4029024 missense possibly damaging 0.46
R6119:Lair1 UTSW 7 4028896 missense probably benign 0.43
R6305:Lair1 UTSW 7 4010728 critical splice donor site probably null
R6915:Lair1 UTSW 7 4055953 missense possibly damaging 0.89
R7964:Lair1 UTSW 7 4010804 missense probably benign 0.22
R7991:Lair1 UTSW 7 4028970 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACTCTCAAGAGATTGGAGTCCC -3'
(R):5'- TCATCTCTAAGCAAACTGTGGG -3'

Sequencing Primer
(F):5'- GGGGAAGTCCTCATGGAGAC -3'
(R):5'- CTCTAAGCAAACTGTGGGTAATG -3'
Posted On2018-07-23