Incidental Mutation 'R6278:Tigd5'
ID527958
Institutional Source Beutler Lab
Gene Symbol Tigd5
Ensembl Gene ENSMUSG00000103906
Gene Nametigger transposable element derived 5
SynonymsFLJ14926
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R6278 (G1)
Quality Score79.0075
Status Validated
Chromosome15
Chromosomal Location75909735-75914535 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 75909993 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 68 (I68T)
Ref Sequence ENSEMBL: ENSMUSP00000141473 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023235] [ENSMUST00000089680] [ENSMUST00000089681] [ENSMUST00000109972] [ENSMUST00000109975] [ENSMUST00000116440] [ENSMUST00000123712] [ENSMUST00000127550] [ENSMUST00000141268] [ENSMUST00000141475] [ENSMUST00000144614] [ENSMUST00000145764] [ENSMUST00000151066] [ENSMUST00000154584] [ENSMUST00000192937]
Predicted Effect probably benign
Transcript: ENSMUST00000023235
SMART Domains Protein: ENSMUSP00000023235
Gene: ENSMUSG00000055762

DomainStartEndE-ValueType
low complexity region 62 75 N/A INTRINSIC
coiled coil region 82 120 N/A INTRINSIC
EF-1_beta_acid 159 186 2.53e-4 SMART
Pfam:EF1_GNE 195 245 3.3e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000055220
Predicted Effect probably benign
Transcript: ENSMUST00000089680
SMART Domains Protein: ENSMUSP00000087109
Gene: ENSMUSG00000055762

DomainStartEndE-ValueType
low complexity region 54 70 N/A INTRINSIC
coiled coil region 77 115 N/A INTRINSIC
EF-1_beta_acid 154 181 2.53e-4 SMART
EF1_GNE 190 276 4.87e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000089681
SMART Domains Protein: ENSMUSP00000087110
Gene: ENSMUSG00000055762

DomainStartEndE-ValueType
low complexity region 32 52 N/A INTRINSIC
low complexity region 66 76 N/A INTRINSIC
internal_repeat_2 108 136 2.92e-5 PROSPERO
low complexity region 137 156 N/A INTRINSIC
internal_repeat_2 231 259 2.92e-5 PROSPERO
internal_repeat_1 244 263 2.02e-6 PROSPERO
internal_repeat_1 389 408 2.02e-6 PROSPERO
low complexity region 441 454 N/A INTRINSIC
coiled coil region 461 499 N/A INTRINSIC
EF-1_beta_acid 538 565 2.53e-4 SMART
EF1_GNE 574 660 4.87e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109972
SMART Domains Protein: ENSMUSP00000105599
Gene: ENSMUSG00000055762

DomainStartEndE-ValueType
low complexity region 35 51 N/A INTRINSIC
coiled coil region 58 96 N/A INTRINSIC
EF-1_beta_acid 135 162 2.53e-4 SMART
EF1_GNE 171 257 4.87e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109975
SMART Domains Protein: ENSMUSP00000105602
Gene: ENSMUSG00000055762

DomainStartEndE-ValueType
low complexity region 32 52 N/A INTRINSIC
low complexity region 66 76 N/A INTRINSIC
internal_repeat_2 108 136 2.92e-5 PROSPERO
low complexity region 137 156 N/A INTRINSIC
internal_repeat_2 231 259 2.92e-5 PROSPERO
internal_repeat_1 244 263 2.02e-6 PROSPERO
internal_repeat_1 389 408 2.02e-6 PROSPERO
low complexity region 441 454 N/A INTRINSIC
coiled coil region 461 499 N/A INTRINSIC
EF-1_beta_acid 538 565 2.53e-4 SMART
EF1_GNE 574 660 4.87e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000116440
SMART Domains Protein: ENSMUSP00000112141
Gene: ENSMUSG00000055762

DomainStartEndE-ValueType
low complexity region 35 51 N/A INTRINSIC
coiled coil region 58 96 N/A INTRINSIC
EF-1_beta_acid 135 162 2.53e-4 SMART
EF1_GNE 171 257 4.87e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123712
SMART Domains Protein: ENSMUSP00000122155
Gene: ENSMUSG00000055762

DomainStartEndE-ValueType
low complexity region 35 51 N/A INTRINSIC
coiled coil region 58 96 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127550
SMART Domains Protein: ENSMUSP00000120735
Gene: ENSMUSG00000055762

DomainStartEndE-ValueType
low complexity region 32 52 N/A INTRINSIC
low complexity region 66 76 N/A INTRINSIC
low complexity region 137 156 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141268
SMART Domains Protein: ENSMUSP00000115553
Gene: ENSMUSG00000055762

DomainStartEndE-ValueType
low complexity region 78 94 N/A INTRINSIC
coiled coil region 101 139 N/A INTRINSIC
EF-1_beta_acid 178 205 2.53e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000141475
SMART Domains Protein: ENSMUSP00000123388
Gene: ENSMUSG00000055762

DomainStartEndE-ValueType
low complexity region 32 52 N/A INTRINSIC
low complexity region 66 76 N/A INTRINSIC
internal_repeat_1 122 136 7.17e-5 PROSPERO
low complexity region 137 156 N/A INTRINSIC
internal_repeat_1 174 188 7.17e-5 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000144614
SMART Domains Protein: ENSMUSP00000123005
Gene: ENSMUSG00000055762

DomainStartEndE-ValueType
low complexity region 62 75 N/A INTRINSIC
coiled coil region 82 120 N/A INTRINSIC
EF-1_beta_acid 159 186 2.53e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000145764
SMART Domains Protein: ENSMUSP00000117782
Gene: ENSMUSG00000055762

DomainStartEndE-ValueType
low complexity region 32 52 N/A INTRINSIC
low complexity region 66 76 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151066
SMART Domains Protein: ENSMUSP00000118889
Gene: ENSMUSG00000055762

DomainStartEndE-ValueType
EF-1_beta_acid 68 95 2.53e-4 SMART
EF1_GNE 104 190 4.87e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000154584
SMART Domains Protein: ENSMUSP00000116360
Gene: ENSMUSG00000055762

DomainStartEndE-ValueType
low complexity region 62 75 N/A INTRINSIC
coiled coil region 82 120 N/A INTRINSIC
EF-1_beta_acid 159 186 1.2e-8 SMART
EF1_GNE 195 280 4.9e-41 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000192937
AA Change: I68T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141473
Gene: ENSMUSG00000103906
AA Change: I68T

DomainStartEndE-ValueType
low complexity region 34 55 N/A INTRINSIC
Pfam:CENP-B_N 63 112 1.6e-10 PFAM
CENPB 128 195 1.41e-13 SMART
Pfam:DDE_1 238 377 8.2e-21 PFAM
low complexity region 554 567 N/A INTRINSIC
low complexity region 569 582 N/A INTRINSIC
Meta Mutation Damage Score 0.1435 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.6%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the tigger subfamily of the pogo superfamily of DNA-mediated transposons in humans. These proteins are related to DNA transposons found in fungi and nematodes, and more distantly to the Tc1 and mariner transposases. They are also very similar to the major mammalian centromere protein B. The exact function of this gene is not known. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm3 T C 7: 119,773,849 S192P probably damaging Het
Amy1 T A 3: 113,561,690 Y348F probably damaging Het
Brpf3 C A 17: 28,821,284 P893H probably benign Het
Cage1 T C 13: 38,016,419 T702A possibly damaging Het
Cdk11b A G 4: 155,649,603 probably benign Het
Cdk5rap3 T C 11: 96,911,903 Y207C probably damaging Het
Cenpc1 T C 5: 86,035,535 K465R probably damaging Het
Cldn14 A C 16: 93,919,598 L120R possibly damaging Het
Cyp2c69 A T 19: 39,843,063 C435* probably null Het
Dmxl2 T A 9: 54,415,762 E1446V probably damaging Het
Dnah17 T A 11: 118,126,290 D208V probably damaging Het
Eif4g3 G T 4: 138,188,083 G1430V possibly damaging Het
Eif5 T A 12: 111,542,793 D284E probably benign Het
Fam47e T C 5: 92,562,517 L125P probably damaging Het
Far1 A G 7: 113,568,137 I476M probably benign Het
Fsip2 A T 2: 82,988,898 I4992L probably benign Het
Gli3 T A 13: 15,725,113 N1028K possibly damaging Het
Gm13128 C T 4: 144,330,267 P7S probably damaging Het
Gucy1a1 T C 3: 82,097,634 K615E probably damaging Het
Gykl1 G T 18: 52,695,208 S496I probably benign Het
Hmcn1 C T 1: 150,697,419 probably null Het
Itga2 T A 13: 114,845,888 H1027L probably benign Het
Kif24 A T 4: 41,423,498 V251E probably damaging Het
Nupr1 T C 7: 126,625,346 Y30C probably damaging Het
Olfr1137 A T 2: 87,711,471 L145* probably null Het
Olfr1475 T A 19: 13,479,755 M148L probably benign Het
Olfr943 T A 9: 39,184,298 I40N probably damaging Het
Olfr998 A G 2: 85,590,998 I153V probably benign Het
P2ry1 T A 3: 61,003,794 I118N possibly damaging Het
Pcdh1 C T 18: 38,199,210 V247M probably benign Het
Pdia5 A G 16: 35,429,923 V222A possibly damaging Het
Plce1 G A 19: 38,725,051 probably null Het
Ppm1m T C 9: 106,197,228 R239G probably damaging Het
Prkcz A T 4: 155,268,195 F492I probably damaging Het
Rpl6 T C 5: 121,208,849 I269T possibly damaging Het
Scoc T C 8: 83,458,336 S2G unknown Het
Spesp1 A T 9: 62,272,639 M329K probably benign Het
Ston2 T C 12: 91,648,330 K435E probably damaging Het
Synj2 A T 17: 5,975,874 L69F probably damaging Het
Tmcc2 A T 1: 132,358,982 M577K probably damaging Het
Tmem131l A T 3: 83,942,491 I263N possibly damaging Het
Trip13 T C 13: 73,913,320 E408G probably benign Het
Txnl4b T C 8: 109,569,103 probably null Het
Ube2o T C 11: 116,539,543 E1123G probably damaging Het
Vmn1r123 A G 7: 21,162,849 H222R possibly damaging Het
Vmn2r73 G T 7: 85,872,932 H66Q probably benign Het
Zc3h13 T A 14: 75,330,423 V1052D probably benign Het
Other mutations in Tigd5
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4516:Tigd5 UTSW 15 75910515 nonsense probably null
R4905:Tigd5 UTSW 15 75911403 missense probably damaging 0.99
R5579:Tigd5 UTSW 15 75911025 missense probably damaging 1.00
R6146:Tigd5 UTSW 15 75910245 missense probably damaging 1.00
R6253:Tigd5 UTSW 15 75911022 missense probably damaging 1.00
R6452:Tigd5 UTSW 15 75911438 nonsense probably null
R6466:Tigd5 UTSW 15 75910503 missense possibly damaging 0.72
R6533:Tigd5 UTSW 15 75910190 missense possibly damaging 0.93
R7084:Tigd5 UTSW 15 75910381 nonsense probably null
R7473:Tigd5 UTSW 15 75909899 missense probably benign
R7510:Tigd5 UTSW 15 75910419 missense probably benign 0.28
Z1176:Tigd5 UTSW 15 75910954 missense probably benign 0.13
Z1177:Tigd5 UTSW 15 75911502 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- GTAATGAAGCTGATGTGCGCAC -3'
(R):5'- TGGCCAGACGCATCTTCTTG -3'

Sequencing Primer
(F):5'- GGTGTCAGGCTCGCTTTCC -3'
(R):5'- GCATCTTCTTGCGCTGCG -3'
Posted On2018-07-23