Incidental Mutation 'R6646:Wdr75'
ID527960
Institutional Source Beutler Lab
Gene Symbol Wdr75
Ensembl Gene ENSMUSG00000025995
Gene NameWD repeat domain 75
Synonyms2410118I19Rik, 1300003A18Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.935) question?
Stock #R6646 (G1)
Quality Score190.009
Status Validated
Chromosome1
Chromosomal Location45795166-45823619 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 45799087 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 52 (L52Q)
Ref Sequence ENSEMBL: ENSMUSP00000117363 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027139] [ENSMUST00000147308]
Predicted Effect probably damaging
Transcript: ENSMUST00000027139
AA Change: L52Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027139
Gene: ENSMUSG00000025995
AA Change: L52Q

DomainStartEndE-ValueType
WD40 4 42 3.82e1 SMART
WD40 45 85 1.25e-9 SMART
WD40 185 230 1.61e-3 SMART
WD40 239 275 4.44e0 SMART
WD40 278 317 7.67e0 SMART
low complexity region 405 417 N/A INTRINSIC
WD40 431 473 7.67e0 SMART
WD40 486 524 3.08e0 SMART
WD40 527 568 3.96e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142145
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143737
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146602
Predicted Effect probably damaging
Transcript: ENSMUST00000147308
AA Change: L52Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117363
Gene: ENSMUSG00000025995
AA Change: L52Q

DomainStartEndE-ValueType
WD40 4 42 3.82e1 SMART
WD40 45 85 1.25e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154436
Meta Mutation Damage Score 0.9260 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.4%
Validation Efficiency 100% (41/41)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T A 10: 82,296,830 E115D unknown Het
Ada G T 2: 163,735,423 N48K probably benign Het
Aldh1a7 C T 19: 20,699,911 A449T possibly damaging Het
Arhgef28 A G 13: 97,939,494 V1344A probably benign Het
Carmil3 A T 14: 55,507,930 E1371D probably damaging Het
Crebbp C T 16: 4,119,806 A698T possibly damaging Het
Dedd2 T C 7: 25,203,613 D307G probably damaging Het
Dennd6b G T 15: 89,186,184 F427L probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Doc2a G A 7: 126,851,619 probably null Het
Dst A G 1: 34,268,807 T6503A possibly damaging Het
Ehmt1 A T 2: 24,806,310 I922K probably damaging Het
Gbp9 A G 5: 105,082,903 I385T probably benign Het
Gipc2 A T 3: 152,094,201 D297E possibly damaging Het
Krt6b T A 15: 101,677,214 Q428L probably damaging Het
Loxl4 T C 19: 42,598,781 D625G probably damaging Het
Lrrn2 C T 1: 132,939,056 P620S probably benign Het
Msh6 T C 17: 87,986,442 V875A possibly damaging Het
Nebl T C 2: 17,376,685 T727A probably damaging Het
Obscn T C 11: 59,082,718 D1929G possibly damaging Het
Pard3b T C 1: 62,161,121 V273A probably benign Het
Pcdhb7 T A 18: 37,343,974 V721E possibly damaging Het
Plaa A T 4: 94,589,978 H82Q probably benign Het
Plcd1 T A 9: 119,075,032 Y278F probably damaging Het
Plxnb1 C A 9: 109,108,827 H1214N probably benign Het
Ptprg C A 14: 11,962,714 P171T probably damaging Het
Rela T G 19: 5,647,104 D446E probably damaging Het
Rpap1 T C 2: 119,780,131 I156V probably benign Het
Rpl15 T C 14: 18,270,040 Y59C probably damaging Het
Scx C A 15: 76,457,921 T107N probably damaging Het
Skint5 T A 4: 113,940,777 K203I possibly damaging Het
Slc16a6 C T 11: 109,453,162 M518I probably benign Het
Sorbs1 C T 19: 40,325,549 G940R probably damaging Het
Synm A T 7: 67,735,127 I487K probably damaging Het
Tcerg1l A T 7: 138,395,183 probably null Het
Vmn2r99 T G 17: 19,380,031 L439R probably damaging Het
Zswim2 T A 2: 83,915,784 R437* probably null Het
Other mutations in Wdr75
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00467:Wdr75 APN 1 45802075 missense probably benign 0.02
IGL00711:Wdr75 APN 1 45823381 missense probably benign 0.00
IGL01350:Wdr75 APN 1 45818260 nonsense probably null
IGL02135:Wdr75 APN 1 45814563 missense probably damaging 1.00
IGL02135:Wdr75 APN 1 45817448 splice site probably null
BB008:Wdr75 UTSW 1 45819635 missense probably benign 0.00
BB018:Wdr75 UTSW 1 45819635 missense probably benign 0.00
FR4976:Wdr75 UTSW 1 45823404 utr 3 prime probably benign
PIT4378001:Wdr75 UTSW 1 45820173 missense probably damaging 0.98
R0060:Wdr75 UTSW 1 45816617 missense probably benign 0.16
R0463:Wdr75 UTSW 1 45819602 missense probably damaging 1.00
R0963:Wdr75 UTSW 1 45817310 missense probably benign 0.07
R1364:Wdr75 UTSW 1 45799062 missense probably benign 0.01
R1382:Wdr75 UTSW 1 45817311 missense probably damaging 1.00
R1562:Wdr75 UTSW 1 45803870 splice site probably null
R1909:Wdr75 UTSW 1 45823403 missense probably benign 0.00
R2968:Wdr75 UTSW 1 45817341 missense probably damaging 1.00
R3972:Wdr75 UTSW 1 45822554 missense probably benign 0.01
R4372:Wdr75 UTSW 1 45806673 unclassified probably benign
R4720:Wdr75 UTSW 1 45822485 missense probably benign 0.05
R4922:Wdr75 UTSW 1 45816478 missense probably damaging 1.00
R5201:Wdr75 UTSW 1 45823359 missense probably benign 0.00
R5242:Wdr75 UTSW 1 45817327 nonsense probably null
R5255:Wdr75 UTSW 1 45799117 missense probably damaging 1.00
R5320:Wdr75 UTSW 1 45799051 missense probably damaging 0.96
R5450:Wdr75 UTSW 1 45812164 missense probably benign 0.26
R6072:Wdr75 UTSW 1 45799051 missense probably damaging 0.96
R6147:Wdr75 UTSW 1 45819538 missense probably benign 0.00
R6341:Wdr75 UTSW 1 45802131 critical splice donor site probably null
R6629:Wdr75 UTSW 1 45812056 missense probably damaging 1.00
R6722:Wdr75 UTSW 1 45805352 splice site probably null
R6750:Wdr75 UTSW 1 45817379 missense probably damaging 1.00
R6850:Wdr75 UTSW 1 45814598 missense probably benign 0.00
R6851:Wdr75 UTSW 1 45823427 missense probably benign
R7172:Wdr75 UTSW 1 45799134 missense probably damaging 1.00
R7248:Wdr75 UTSW 1 45817400 missense probably damaging 1.00
R7809:Wdr75 UTSW 1 45823436 missense probably benign 0.00
R7931:Wdr75 UTSW 1 45819635 missense probably benign 0.00
R7937:Wdr75 UTSW 1 45819639 missense probably benign 0.17
R8171:Wdr75 UTSW 1 45822546 missense probably benign 0.00
R8218:Wdr75 UTSW 1 45818182 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGTCTCATATCCTCATATGGTTGAC -3'
(R):5'- CCATGGGCAGTGTAGTTCTAG -3'

Sequencing Primer
(F):5'- CATTACAGATGGTTGTGAGCCACC -3'
(R):5'- CAGTGTAGTTCTAGGCTATGGACCTC -3'
Posted On2018-07-24