Mutagenetix > Incidental Mutation

Incidental Mutation 'R6646:Pard3b'

527961

Institutional Source

Beutler Lab

Gene Symbol

Pard3b

Ensembl Gene

ENSMUSG00000052062

Gene Name

par-3 family cell polarity regulator beta

Synonyms

PAR3beta, 1810008K04Rik, 2810455B10Rik, PAR3B, 2010002N16Rik, Als2cr19, PAR3L

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6646 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

61638824-62642284 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 62161121 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 273 (V273A)

Ref Sequence

ENSEMBL: ENSMUSP00000092510 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046673] [ENSMUST00000075374] [ENSMUST00000094906]

AlphaFold

Q9CSB4

Predicted Effect

probably benign
Transcript: ENSMUST00000046673
AA Change: V273A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000040439
Gene: ENSMUSG00000052062
AA Change: V273A

Domain	Start	End	E-Value	Type
Pfam:DUF3534	1	143	1.2e-66	PFAM
PDZ	211	291	1.5e-4	SMART
low complexity region	376	388	N/A	INTRINSIC
PDZ	391	470	2.5e-24	SMART
internal_repeat_1	479	515	4.63e-5	PROSPERO
low complexity region	527	537	N/A	INTRINSIC
low complexity region	594	601	N/A	INTRINSIC
low complexity region	677	688	N/A	INTRINSIC
coiled coil region	761	808	N/A	INTRINSIC
coiled coil region	839	866	N/A	INTRINSIC
low complexity region	1075	1083	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000075374
AA Change: V273A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000074837
Gene: ENSMUSG00000052062
AA Change: V273A

Domain	Start	End	E-Value	Type
Pfam:DUF3534	1	143	8.2e-66	PFAM
PDZ	211	291	1.5e-4	SMART
low complexity region	376	388	N/A	INTRINSIC
PDZ	391	470	2.5e-24	SMART
low complexity region	487	498	N/A	INTRINSIC
PDZ	507	592	6.17e-15	SMART
low complexity region	656	663	N/A	INTRINSIC
low complexity region	739	750	N/A	INTRINSIC
coiled coil region	823	870	N/A	INTRINSIC
coiled coil region	901	928	N/A	INTRINSIC
low complexity region	1137	1145	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000094906
AA Change: V273A

PolyPhen 2 Score 0.318 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000092510
Gene: ENSMUSG00000052062
AA Change: V273A

Domain	Start	End	E-Value	Type
Pfam:DUF3534	1	143	1.1e-66	PFAM
PDZ	211	291	1.5e-4	SMART
low complexity region	376	388	N/A	INTRINSIC
PDZ	391	470	2.5e-24	SMART
low complexity region	487	498	N/A	INTRINSIC
PDZ	507	592	6.17e-15	SMART
low complexity region	656	663	N/A	INTRINSIC
low complexity region	739	750	N/A	INTRINSIC
coiled coil region	823	870	N/A	INTRINSIC
low complexity region	901	913	N/A	INTRINSIC
low complexity region	1038	1046	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000188325

Meta Mutation Damage Score

0.2039

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.6%
20x: 92.4%

Validation Efficiency

100% (41/41)

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932415D10Rik	T	A	10: 82,296,830	E115D	unknown	Het
Ada	G	T	2: 163,735,423	N48K	probably benign	Het
Aldh1a7	C	T	19: 20,699,911	A449T	possibly damaging	Het
Arhgef28	A	G	13: 97,939,494	V1344A	probably benign	Het
Carmil3	A	T	14: 55,507,930	E1371D	probably damaging	Het
Crebbp	C	T	16: 4,119,806	A698T	possibly damaging	Het
Dedd2	T	C	7: 25,203,613	D307G	probably damaging	Het
Dennd6b	G	T	15: 89,186,184	F427L	probably damaging	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Homo
Doc2a	G	A	7: 126,851,619		probably null	Het
Dst	A	G	1: 34,268,807	T6503A	possibly damaging	Het
Ehmt1	A	T	2: 24,806,310	I922K	probably damaging	Het
Gbp9	A	G	5: 105,082,903	I385T	probably benign	Het
Gipc2	A	T	3: 152,094,201	D297E	possibly damaging	Het
Krt6b	T	A	15: 101,677,214	Q428L	probably damaging	Het
Loxl4	T	C	19: 42,598,781	D625G	probably damaging	Het
Lrrn2	C	T	1: 132,939,056	P620S	probably benign	Het
Msh6	T	C	17: 87,986,442	V875A	possibly damaging	Het
Nebl	T	C	2: 17,376,685	T727A	probably damaging	Het
Obscn	T	C	11: 59,082,718	D1929G	possibly damaging	Het
Pcdhb7	T	A	18: 37,343,974	V721E	possibly damaging	Het
Plaa	A	T	4: 94,589,978	H82Q	probably benign	Het
Plcd1	T	A	9: 119,075,032	Y278F	probably damaging	Het
Plxnb1	C	A	9: 109,108,827	H1214N	probably benign	Het
Ptprg	C	A	14: 11,962,714	P171T	probably damaging	Het
Rela	T	G	19: 5,647,104	D446E	probably damaging	Het
Rpap1	T	C	2: 119,780,131	I156V	probably benign	Het
Rpl15	T	C	14: 18,270,040	Y59C	probably damaging	Het
Scx	C	A	15: 76,457,921	T107N	probably damaging	Het
Skint5	T	A	4: 113,940,777	K203I	possibly damaging	Het
Slc16a6	C	T	11: 109,453,162	M518I	probably benign	Het
Sorbs1	C	T	19: 40,325,549	G940R	probably damaging	Het
Synm	A	T	7: 67,735,127	I487K	probably damaging	Het
Tcerg1l	A	T	7: 138,395,183		probably null	Het
Vmn2r99	T	G	17: 19,380,031	L439R	probably damaging	Het
Wdr75	T	A	1: 45,799,087	L52Q	probably damaging	Het
Zswim2	T	A	2: 83,915,784	R437*	probably null	Het

Other mutations in Pard3b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00428:Pard3b	APN	1	62161198	missense	probably damaging	0.99
IGL01363:Pard3b	APN	1	62637640	missense	probably damaging	1.00
IGL01509:Pard3b	APN	1	62161248	missense	possibly damaging	0.54
IGL01611:Pard3b	APN	1	62637862	missense	probably damaging	0.96
IGL01651:Pard3b	APN	1	62479804	intron	probably benign
IGL01670:Pard3b	APN	1	62211648	missense	probably damaging	1.00
IGL02156:Pard3b	APN	1	61767950	missense	possibly damaging	0.84
IGL02232:Pard3b	APN	1	62166382	missense	probably damaging	1.00
IGL02450:Pard3b	APN	1	62532676	missense	possibly damaging	0.68
IGL03064:Pard3b	APN	1	62198771	splice site	probably benign
R0040:Pard3b	UTSW	1	62637820	missense	probably damaging	1.00
R0040:Pard3b	UTSW	1	62637820	missense	probably damaging	1.00
R0060:Pard3b	UTSW	1	61639315	missense	probably damaging	0.97
R0157:Pard3b	UTSW	1	62211633	missense	probably damaging	0.96
R0333:Pard3b	UTSW	1	62230212	missense	probably benign	0.00
R0448:Pard3b	UTSW	1	62166469	missense	probably damaging	1.00
R0465:Pard3b	UTSW	1	62211718	splice site	probably benign
R0497:Pard3b	UTSW	1	62440008	splice site	probably null
R1264:Pard3b	UTSW	1	62164157	missense	probably damaging	1.00
R1468:Pard3b	UTSW	1	62345029	missense	probably benign	0.00
R1468:Pard3b	UTSW	1	62345029	missense	probably benign	0.00
R1482:Pard3b	UTSW	1	62166367	missense	probably damaging	1.00
R1554:Pard3b	UTSW	1	62637894	missense	probably damaging	0.97
R1836:Pard3b	UTSW	1	62637604	missense	probably benign	0.03
R2005:Pard3b	UTSW	1	62144891	missense	probably benign	0.12
R2220:Pard3b	UTSW	1	62479683	nonsense	probably null
R2435:Pard3b	UTSW	1	62587738	missense	probably damaging	1.00
R3015:Pard3b	UTSW	1	62344878	missense	probably damaging	1.00
R3688:Pard3b	UTSW	1	62479569	missense	probably benign
R3712:Pard3b	UTSW	1	62343978	missense	probably damaging	1.00
R3799:Pard3b	UTSW	1	62161229	missense	probably benign	0.06
R3942:Pard3b	UTSW	1	62159452	missense	probably damaging	1.00
R4683:Pard3b	UTSW	1	62216516	missense	probably benign
R4729:Pard3b	UTSW	1	62211684	missense	probably damaging	1.00
R4898:Pard3b	UTSW	1	61768000	missense	probably damaging	1.00
R4981:Pard3b	UTSW	1	62344060	missense	probably damaging	1.00
R5049:Pard3b	UTSW	1	62161161	missense	probably benign	0.01
R5223:Pard3b	UTSW	1	62344113	missense	probably damaging	1.00
R5476:Pard3b	UTSW	1	62010406	missense	probably benign	0.10
R5541:Pard3b	UTSW	1	61639343	missense	probably damaging	1.00
R5672:Pard3b	UTSW	1	62010466	missense	probably benign	0.11
R5714:Pard3b	UTSW	1	62637916	missense	probably null	0.99
R5722:Pard3b	UTSW	1	62440001	splice site	probably null
R5793:Pard3b	UTSW	1	61767973	missense	probably damaging	1.00
R5930:Pard3b	UTSW	1	61768130	intron	probably benign
R5950:Pard3b	UTSW	1	62216531	missense	probably benign	0.04
R5997:Pard3b	UTSW	1	62076409	missense	probably damaging	1.00
R6720:Pard3b	UTSW	1	62159470	missense	probably damaging	0.99
R6809:Pard3b	UTSW	1	62161181	missense	probably damaging	1.00
R7148:Pard3b	UTSW	1	62440032	missense	probably benign	0.01
R7847:Pard3b	UTSW	1	62343934	missense	probably benign	0.00
R7879:Pard3b	UTSW	1	62159511	missense	possibly damaging	0.65
R8048:Pard3b	UTSW	1	62153989	missense	probably damaging	1.00
R8125:Pard3b	UTSW	1	61767984	missense	probably damaging	1.00
R8329:Pard3b	UTSW	1	62637798	missense	probably benign	0.30
R8766:Pard3b	UTSW	1	62159478	missense	probably benign	0.35
R8833:Pard3b	UTSW	1	62344999	missense	probably benign	0.00
R8889:Pard3b	UTSW	1	62637867	missense	probably damaging	0.97
R8892:Pard3b	UTSW	1	62637867	missense	probably damaging	0.97
R8907:Pard3b	UTSW	1	62344135	missense	probably benign	0.39
R8909:Pard3b	UTSW	1	62344135	missense	probably benign	0.39
R9215:Pard3b	UTSW	1	62164185	missense	probably damaging	1.00
R9310:Pard3b	UTSW	1	62166369	missense	probably damaging	0.99
R9542:Pard3b	UTSW	1	62211627	nonsense	probably null
Z1176:Pard3b	UTSW	1	62238892	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- ACAGTCACCATGCATGTGTAG -3'
(R):5'- GATGTACTGCCTTCAGACCTG -3'

Sequencing Primer
(F):5'- ACCATGCATGTGTAGCCAGTG -3'
(R):5'- TCAGACCTGGTTTCCCACGG -3'

Posted On

2018-07-24