Mutagenetix > Incidental Mutations

Incidental Mutation 'R6646:Zswim2'

527966

Institutional Source

Beutler Lab

Gene Symbol

Zswim2

Ensembl Gene

ENSMUSG00000034552

Gene Name

zinc finger SWIM-type containing 2

Synonyms

4933437F18Rik, MEX, 1700025P14Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.055) question?

Stock #

R6646 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

83915079-83941228 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 83915784 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Stop codon at position 437 (R437*)

Ref Sequence

ENSEMBL: ENSMUSP00000044913 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038223] [ENSMUST00000152829]

Predicted Effect

probably null
Transcript: ENSMUST00000038223
AA Change: R437*

SMART Domains

Protein: ENSMUSP00000044913
Gene: ENSMUSG00000034552
AA Change: R437*

Domain	Start	End	E-Value	Type
Pfam:SWIM	54	87	1.4e-7	PFAM
RING	147	198	8.3e-5	SMART
ZnF_ZZ	229	273	1.8e-5	SMART
RING	344	385	1.3e-7	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000152829

SMART Domains

Protein: ENSMUSP00000119439
Gene: ENSMUSG00000034552

Domain	Start	End	E-Value	Type
Pfam:SWIM	54	87	1.6e-10	PFAM
RING	147	198	1.69e-2	SMART
ZnF_ZZ	229	273	3.65e-3	SMART
Blast:RING	344	365	3e-6	BLAST

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.6%
20x: 92.4%

Validation Efficiency

100% (41/41)

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932415D10Rik	T	A	10: 82,296,830	E115D	unknown	Het
Ada	G	T	2: 163,735,423	N48K	probably benign	Het
Aldh1a7	C	T	19: 20,699,911	A449T	possibly damaging	Het
Arhgef28	A	G	13: 97,939,494	V1344A	probably benign	Het
Carmil3	A	T	14: 55,507,930	E1371D	probably damaging	Het
Crebbp	C	T	16: 4,119,806	A698T	possibly damaging	Het
Dedd2	T	C	7: 25,203,613	D307G	probably damaging	Het
Dennd6b	G	T	15: 89,186,184	F427L	probably damaging	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Homo
Doc2a	G	A	7: 126,851,619		probably null	Het
Dst	A	G	1: 34,268,807	T6503A	possibly damaging	Het
Ehmt1	A	T	2: 24,806,310	I922K	probably damaging	Het
Gbp9	A	G	5: 105,082,903	I385T	probably benign	Het
Gipc2	A	T	3: 152,094,201	D297E	possibly damaging	Het
Krt6b	T	A	15: 101,677,214	Q428L	probably damaging	Het
Loxl4	T	C	19: 42,598,781	D625G	probably damaging	Het
Lrrn2	C	T	1: 132,939,056	P620S	probably benign	Het
Msh6	T	C	17: 87,986,442	V875A	possibly damaging	Het
Nebl	T	C	2: 17,376,685	T727A	probably damaging	Het
Obscn	T	C	11: 59,082,718	D1929G	possibly damaging	Het
Pard3b	T	C	1: 62,161,121	V273A	probably benign	Het
Pcdhb7	T	A	18: 37,343,974	V721E	possibly damaging	Het
Plaa	A	T	4: 94,589,978	H82Q	probably benign	Het
Plcd1	T	A	9: 119,075,032	Y278F	probably damaging	Het
Plxnb1	C	A	9: 109,108,827	H1214N	probably benign	Het
Ptprg	C	A	14: 11,962,714	P171T	probably damaging	Het
Rela	T	G	19: 5,647,104	D446E	probably damaging	Het
Rpap1	T	C	2: 119,780,131	I156V	probably benign	Het
Rpl15	T	C	14: 18,270,040	Y59C	probably damaging	Het
Scx	C	A	15: 76,457,921	T107N	probably damaging	Het
Skint5	T	A	4: 113,940,777	K203I	possibly damaging	Het
Slc16a6	C	T	11: 109,453,162	M518I	probably benign	Het
Sorbs1	C	T	19: 40,325,549	G940R	probably damaging	Het
Synm	A	T	7: 67,735,127	I487K	probably damaging	Het
Tcerg1l	A	T	7: 138,395,183		probably null	Het
Vmn2r99	T	G	17: 19,380,031	L439R	probably damaging	Het
Wdr75	T	A	1: 45,799,087	L52Q	probably damaging	Het

Other mutations in Zswim2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00844:Zswim2	APN	2	83923771	missense	probably benign	0.00
IGL01140:Zswim2	APN	2	83915328	missense	probably benign	0.06
IGL01362:Zswim2	APN	2	83915346	missense	probably benign	0.09
IGL01768:Zswim2	APN	2	83917957	missense	probably benign	0.00
IGL02166:Zswim2	APN	2	83915406	nonsense	probably null
IGL02187:Zswim2	APN	2	83923638	missense	probably damaging	0.98
IGL02239:Zswim2	APN	2	83938763	nonsense	probably null
IGL02629:Zswim2	APN	2	83925209	missense	possibly damaging	0.94
R0609:Zswim2	UTSW	2	83923659	missense	probably benign	0.02
R0943:Zswim2	UTSW	2	83917998	missense	possibly damaging	0.88
R0946:Zswim2	UTSW	2	83923759	missense	probably benign	0.10
R1006:Zswim2	UTSW	2	83915393	missense	probably damaging	0.97
R1191:Zswim2	UTSW	2	83923695	missense	possibly damaging	0.60
R1309:Zswim2	UTSW	2	83938756	missense	probably damaging	1.00
R1549:Zswim2	UTSW	2	83923748	missense	probably benign	0.24
R1563:Zswim2	UTSW	2	83915282	missense	possibly damaging	0.71
R1739:Zswim2	UTSW	2	83915340	nonsense	probably null
R1994:Zswim2	UTSW	2	83915663	missense	possibly damaging	0.95
R4039:Zswim2	UTSW	2	83915994	missense	probably damaging	1.00
R4645:Zswim2	UTSW	2	83915547	missense	probably benign	0.00
R4738:Zswim2	UTSW	2	83915395	missense	probably benign	0.16
R4855:Zswim2	UTSW	2	83916843	critical splice donor site	probably null
R4933:Zswim2	UTSW	2	83925227	missense	probably damaging	1.00
R4963:Zswim2	UTSW	2	83925110	missense	probably damaging	1.00
R5153:Zswim2	UTSW	2	83939666	missense	possibly damaging	0.75
R5401:Zswim2	UTSW	2	83925245	missense	possibly damaging	0.94
R5698:Zswim2	UTSW	2	83925183	missense	possibly damaging	0.92
R6002:Zswim2	UTSW	2	83915688	missense	probably damaging	0.98
R6396:Zswim2	UTSW	2	83923718	missense	probably damaging	1.00
R6447:Zswim2	UTSW	2	83915113	splice site	probably null
R6717:Zswim2	UTSW	2	83915409	missense	probably benign	0.02
R6735:Zswim2	UTSW	2	83923761	missense	probably benign	0.04
R6830:Zswim2	UTSW	2	83939684	missense	probably damaging	1.00
R7056:Zswim2	UTSW	2	83920748	critical splice acceptor site	probably null
R7088:Zswim2	UTSW	2	83915727	nonsense	probably null
R7383:Zswim2	UTSW	2	83915328	missense	possibly damaging	0.95
R7440:Zswim2	UTSW	2	83920719	missense	probably damaging	1.00
R7747:Zswim2	UTSW	2	83915607	missense	probably damaging	0.97
R7955:Zswim2	UTSW	2	83916883	missense	probably benign	0.00
R7983:Zswim2	UTSW	2	83923567	critical splice donor site	probably null
X0018:Zswim2	UTSW	2	83941094	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- TCCCTTCCAGTGAGACAAATAATG -3'
(R):5'- ATGCCCGATTGACAGACAAG -3'

Sequencing Primer
(F):5'- CAGATATGTGGGGAACTGTTTGC -3'
(R):5'- AGTCATATATAACCCTCTGATCTGG -3'

Posted On

2018-07-24