Incidental Mutation 'R6646:Ada'
ID527968
Institutional Source Beutler Lab
Gene Symbol Ada
Ensembl Gene ENSMUSG00000017697
Gene Nameadenosine deaminase
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6646 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location163726584-163750239 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 163735423 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 48 (N48K)
Ref Sequence ENSEMBL: ENSMUSP00000017841 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017841]
PDB Structure
ADA STRUCTURE COMPLEXED WITH DEOXYCOFORMYCIN AT PH 7.0 [X-RAY DIFFRACTION]
ADA STRUCTURE COMPLEXED WITH PURINE RIBOSIDE AT PH 7.0 [X-RAY DIFFRACTION]
A PRE-TRANSITION STATE MIMIC OF AN ENZYME: X-RAY STRUCTURE OF ADENOSINE DEAMINASE WITH BOUND 1-DEAZA-ADENOSINE AND ZINC-ACTIVATED WATER [X-RAY DIFFRACTION]
MURINE ADENOSINE DEAMINASE (D295E) [X-RAY DIFFRACTION]
MURINE ADENOSINE DEAMINASE (D296A) [X-RAY DIFFRACTION]
ADENOSINE DEAMINASE (HIS 238 ALA MUTANT) [X-RAY DIFFRACTION]
ADENOSINE DEAMINASE (HIS 238 GLU MUTANT) [X-RAY DIFFRACTION]
ATOMIC STRUCTURE OF ADENOSINE DEAMINASE COMPLEXED WITH A TRANSITION-STATE ANALOG: UNDERSTANDING CATALYSIS AND IMMUNODEFICIENCY MUTATIONS [X-RAY DIFFRACTION]
Crystal structuore of adenosine deaminase from mus musculus complexed with 9-deazainosine [X-RAY DIFFRACTION]
Crystal structure of holo mADA at 1.6 A resolution [X-RAY DIFFRACTION]
>> 2 additional structures at PDB <<
Predicted Effect probably benign
Transcript: ENSMUST00000017841
AA Change: N48K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000017841
Gene: ENSMUSG00000017697
AA Change: N48K

DomainStartEndE-ValueType
Pfam:A_deaminase 8 346 1.3e-111 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156939
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.4%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that catalyzes the hydrolysis of adenosine to inosine. Various mutations have been described for this gene and have been linked to human diseases. Deficiency in this enzyme causes a form of severe combined immunodeficiency disease (SCID), in which there is dysfunction of both B and T lymphocytes with impaired cellular immunity and decreased production of immunoglobulins, whereas elevated levels of this enzyme have been associated with congenital hemolytic anemia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene die perinatally with defective purine metabolism and severe liver cell degeneration, but lack thymic abnormalities. Replacement of placental ADA can rescue ADA-deficient fetuses, resulting in mice that are T and B-cell deficient, have elevated dATP levels, and immune deficiencies resembling human ADA deficiency. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T A 10: 82,296,830 E115D unknown Het
Aldh1a7 C T 19: 20,699,911 A449T possibly damaging Het
Arhgef28 A G 13: 97,939,494 V1344A probably benign Het
Carmil3 A T 14: 55,507,930 E1371D probably damaging Het
Crebbp C T 16: 4,119,806 A698T possibly damaging Het
Dedd2 T C 7: 25,203,613 D307G probably damaging Het
Dennd6b G T 15: 89,186,184 F427L probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Doc2a G A 7: 126,851,619 probably null Het
Dst A G 1: 34,268,807 T6503A possibly damaging Het
Ehmt1 A T 2: 24,806,310 I922K probably damaging Het
Gbp9 A G 5: 105,082,903 I385T probably benign Het
Gipc2 A T 3: 152,094,201 D297E possibly damaging Het
Krt6b T A 15: 101,677,214 Q428L probably damaging Het
Loxl4 T C 19: 42,598,781 D625G probably damaging Het
Lrrn2 C T 1: 132,939,056 P620S probably benign Het
Msh6 T C 17: 87,986,442 V875A possibly damaging Het
Nebl T C 2: 17,376,685 T727A probably damaging Het
Obscn T C 11: 59,082,718 D1929G possibly damaging Het
Pard3b T C 1: 62,161,121 V273A probably benign Het
Pcdhb7 T A 18: 37,343,974 V721E possibly damaging Het
Plaa A T 4: 94,589,978 H82Q probably benign Het
Plcd1 T A 9: 119,075,032 Y278F probably damaging Het
Plxnb1 C A 9: 109,108,827 H1214N probably benign Het
Ptprg C A 14: 11,962,714 P171T probably damaging Het
Rela T G 19: 5,647,104 D446E probably damaging Het
Rpap1 T C 2: 119,780,131 I156V probably benign Het
Rpl15 T C 14: 18,270,040 Y59C probably damaging Het
Scx C A 15: 76,457,921 T107N probably damaging Het
Skint5 T A 4: 113,940,777 K203I possibly damaging Het
Slc16a6 C T 11: 109,453,162 M518I probably benign Het
Sorbs1 C T 19: 40,325,549 G940R probably damaging Het
Synm A T 7: 67,735,127 I487K probably damaging Het
Tcerg1l A T 7: 138,395,183 probably null Het
Vmn2r99 T G 17: 19,380,031 L439R probably damaging Het
Wdr75 T A 1: 45,799,087 L52Q probably damaging Het
Zswim2 T A 2: 83,915,784 R437* probably null Het
Other mutations in Ada
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01686:Ada APN 2 163730316 missense probably benign 0.02
IGL02414:Ada APN 2 163730040 missense probably benign
IGL02973:Ada APN 2 163731133 missense probably benign 0.01
R0053:Ada UTSW 2 163732292 missense probably damaging 0.99
R0076:Ada UTSW 2 163727603 unclassified probably benign
R0305:Ada UTSW 2 163728157 missense probably benign 0.00
R0463:Ada UTSW 2 163730351 missense probably benign 0.00
R0464:Ada UTSW 2 163732964 nonsense probably null
R0701:Ada UTSW 2 163730075 missense probably benign 0.30
R1474:Ada UTSW 2 163732894 missense possibly damaging 0.94
R4044:Ada UTSW 2 163735460 missense probably damaging 0.96
R4589:Ada UTSW 2 163732948 missense possibly damaging 0.94
R5114:Ada UTSW 2 163730486 missense probably benign 0.15
R5424:Ada UTSW 2 163728125 nonsense probably null
R5753:Ada UTSW 2 163735398 missense probably benign 0.00
R6392:Ada UTSW 2 163728217 missense probably damaging 1.00
R6501:Ada UTSW 2 163728188 splice site probably null
R7651:Ada UTSW 2 163732355 missense probably damaging 0.98
R7669:Ada UTSW 2 163728191 nonsense probably null
R7803:Ada UTSW 2 163735368 missense probably benign 0.00
Z1088:Ada UTSW 2 163728116 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GTGCAGAGTGCCTTGTACAG -3'
(R):5'- GGCTTCCAGTCTGTTCCATG -3'

Sequencing Primer
(F):5'- AGTGCCTTGTACAGCAGCAG -3'
(R):5'- CATTGGATCCCCTGGAATTAGAG -3'
Posted On2018-07-24