Incidental Mutation 'R6646:Gipc2'
ID527969
Institutional Source Beutler Lab
Gene Symbol Gipc2
Ensembl Gene ENSMUSG00000039131
Gene NameGIPC PDZ domain containing family, member 2
SynonymsSemcap2, 2200002N01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.151) question?
Stock #R6646 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location152093533-152166230 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 152094201 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 297 (D297E)
Ref Sequence ENSEMBL: ENSMUSP00000037328 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046614]
Predicted Effect possibly damaging
Transcript: ENSMUST00000046614
AA Change: D297E

PolyPhen 2 Score 0.609 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000037328
Gene: ENSMUSG00000039131
AA Change: D297E

DomainStartEndE-ValueType
low complexity region 8 18 N/A INTRINSIC
PDZ 125 199 7.04e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128741
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130196
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152283
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152680
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200501
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.4%
Validation Efficiency 100% (41/41)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T A 10: 82,296,830 E115D unknown Het
Ada G T 2: 163,735,423 N48K probably benign Het
Aldh1a7 C T 19: 20,699,911 A449T possibly damaging Het
Arhgef28 A G 13: 97,939,494 V1344A probably benign Het
Carmil3 A T 14: 55,507,930 E1371D probably damaging Het
Crebbp C T 16: 4,119,806 A698T possibly damaging Het
Dedd2 T C 7: 25,203,613 D307G probably damaging Het
Dennd6b G T 15: 89,186,184 F427L probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Doc2a G A 7: 126,851,619 probably null Het
Dst A G 1: 34,268,807 T6503A possibly damaging Het
Ehmt1 A T 2: 24,806,310 I922K probably damaging Het
Gbp9 A G 5: 105,082,903 I385T probably benign Het
Krt6b T A 15: 101,677,214 Q428L probably damaging Het
Loxl4 T C 19: 42,598,781 D625G probably damaging Het
Lrrn2 C T 1: 132,939,056 P620S probably benign Het
Msh6 T C 17: 87,986,442 V875A possibly damaging Het
Nebl T C 2: 17,376,685 T727A probably damaging Het
Obscn T C 11: 59,082,718 D1929G possibly damaging Het
Pard3b T C 1: 62,161,121 V273A probably benign Het
Pcdhb7 T A 18: 37,343,974 V721E possibly damaging Het
Plaa A T 4: 94,589,978 H82Q probably benign Het
Plcd1 T A 9: 119,075,032 Y278F probably damaging Het
Plxnb1 C A 9: 109,108,827 H1214N probably benign Het
Ptprg C A 14: 11,962,714 P171T probably damaging Het
Rela T G 19: 5,647,104 D446E probably damaging Het
Rpap1 T C 2: 119,780,131 I156V probably benign Het
Rpl15 T C 14: 18,270,040 Y59C probably damaging Het
Scx C A 15: 76,457,921 T107N probably damaging Het
Skint5 T A 4: 113,940,777 K203I possibly damaging Het
Slc16a6 C T 11: 109,453,162 M518I probably benign Het
Sorbs1 C T 19: 40,325,549 G940R probably damaging Het
Synm A T 7: 67,735,127 I487K probably damaging Het
Tcerg1l A T 7: 138,395,183 probably null Het
Vmn2r99 T G 17: 19,380,031 L439R probably damaging Het
Wdr75 T A 1: 45,799,087 L52Q probably damaging Het
Zswim2 T A 2: 83,915,784 R437* probably null Het
Other mutations in Gipc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Gipc2 APN 3 152137578 missense probably damaging 1.00
IGL01065:Gipc2 APN 3 152102657 missense possibly damaging 0.66
IGL01524:Gipc2 APN 3 152137577 missense probably damaging 1.00
IGL01690:Gipc2 APN 3 152128134 missense probably damaging 1.00
IGL01697:Gipc2 APN 3 152137608 missense probably benign 0.22
IGL02223:Gipc2 APN 3 152128050 missense probably damaging 1.00
R0400:Gipc2 UTSW 3 152165668 missense probably damaging 0.99
R0490:Gipc2 UTSW 3 152102654 missense possibly damaging 0.90
R1119:Gipc2 UTSW 3 152094196 missense probably damaging 1.00
R1168:Gipc2 UTSW 3 152107997 missense probably benign 0.10
R1663:Gipc2 UTSW 3 152094164 missense probably benign
R2365:Gipc2 UTSW 3 152128194 missense possibly damaging 0.89
R2434:Gipc2 UTSW 3 152137680 missense probably benign 0.01
R3816:Gipc2 UTSW 3 152165844 missense probably benign 0.02
R3835:Gipc2 UTSW 3 152128186 missense probably damaging 0.98
R5069:Gipc2 UTSW 3 152094248 missense probably benign 0.12
R5240:Gipc2 UTSW 3 152102662 missense possibly damaging 0.73
R5625:Gipc2 UTSW 3 152165904 utr 5 prime probably benign
R6956:Gipc2 UTSW 3 152094248 missense probably benign 0.12
R7258:Gipc2 UTSW 3 152165715 missense probably damaging 1.00
R7259:Gipc2 UTSW 3 152128056 missense probably damaging 0.99
R8035:Gipc2 UTSW 3 152094229 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TTCGAAGACTGTATCTCATACACAG -3'
(R):5'- GAAATCTATCCCTGCCCCTTGG -3'

Sequencing Primer
(F):5'- GACTGTATCTCATACACAGGAGGC -3'
(R):5'- GGTAAGTAGTCATGGTCCTGCTAAC -3'
Posted On2018-07-24