Incidental Mutation 'R6646:Dedd2'
ID527973
Institutional Source Beutler Lab
Gene Symbol Dedd2
Ensembl Gene ENSMUSG00000054499
Gene Namedeath effector domain-containing DNA binding protein 2
SynonymsFLAME-3, 2410050E11Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.150) question?
Stock #R6646 (G1)
Quality Score166.009
Status Validated
Chromosome7
Chromosomal Location25199915-25220615 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 25203613 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 307 (D307G)
Ref Sequence ENSEMBL: ENSMUSP00000146052 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058702] [ENSMUST00000205271]
Predicted Effect probably damaging
Transcript: ENSMUST00000058702
AA Change: D307G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000049763
Gene: ENSMUSG00000054499
AA Change: D307G

DomainStartEndE-ValueType
DED 24 104 6.34e-13 SMART
low complexity region 130 147 N/A INTRINSIC
low complexity region 157 182 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000205271
AA Change: D307G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206750
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.4%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear-localized protein containing a death effector domain (DED). The encoded protein may regulate the trafficking of caspases and other proteins into the nucleus during death receptor-induced apoptosis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T A 10: 82,296,830 E115D unknown Het
Ada G T 2: 163,735,423 N48K probably benign Het
Aldh1a7 C T 19: 20,699,911 A449T possibly damaging Het
Arhgef28 A G 13: 97,939,494 V1344A probably benign Het
Carmil3 A T 14: 55,507,930 E1371D probably damaging Het
Crebbp C T 16: 4,119,806 A698T possibly damaging Het
Dennd6b G T 15: 89,186,184 F427L probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Doc2a G A 7: 126,851,619 probably null Het
Dst A G 1: 34,268,807 T6503A possibly damaging Het
Ehmt1 A T 2: 24,806,310 I922K probably damaging Het
Gbp9 A G 5: 105,082,903 I385T probably benign Het
Gipc2 A T 3: 152,094,201 D297E possibly damaging Het
Krt6b T A 15: 101,677,214 Q428L probably damaging Het
Loxl4 T C 19: 42,598,781 D625G probably damaging Het
Lrrn2 C T 1: 132,939,056 P620S probably benign Het
Msh6 T C 17: 87,986,442 V875A possibly damaging Het
Nebl T C 2: 17,376,685 T727A probably damaging Het
Obscn T C 11: 59,082,718 D1929G possibly damaging Het
Pard3b T C 1: 62,161,121 V273A probably benign Het
Pcdhb7 T A 18: 37,343,974 V721E possibly damaging Het
Plaa A T 4: 94,589,978 H82Q probably benign Het
Plcd1 T A 9: 119,075,032 Y278F probably damaging Het
Plxnb1 C A 9: 109,108,827 H1214N probably benign Het
Ptprg C A 14: 11,962,714 P171T probably damaging Het
Rela T G 19: 5,647,104 D446E probably damaging Het
Rpap1 T C 2: 119,780,131 I156V probably benign Het
Rpl15 T C 14: 18,270,040 Y59C probably damaging Het
Scx C A 15: 76,457,921 T107N probably damaging Het
Skint5 T A 4: 113,940,777 K203I possibly damaging Het
Slc16a6 C T 11: 109,453,162 M518I probably benign Het
Sorbs1 C T 19: 40,325,549 G940R probably damaging Het
Synm A T 7: 67,735,127 I487K probably damaging Het
Tcerg1l A T 7: 138,395,183 probably null Het
Vmn2r99 T G 17: 19,380,031 L439R probably damaging Het
Wdr75 T A 1: 45,799,087 L52Q probably damaging Het
Zswim2 T A 2: 83,915,784 R437* probably null Het
Other mutations in Dedd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0346:Dedd2 UTSW 7 25211269 missense possibly damaging 0.46
R0480:Dedd2 UTSW 7 25203625 missense probably damaging 1.00
R0838:Dedd2 UTSW 7 25211187 missense probably benign 0.10
R5000:Dedd2 UTSW 7 25203643 missense possibly damaging 0.91
R5085:Dedd2 UTSW 7 25218986 missense probably damaging 1.00
R6082:Dedd2 UTSW 7 25211290 missense probably benign 0.02
R6083:Dedd2 UTSW 7 25211290 missense probably benign 0.02
R6084:Dedd2 UTSW 7 25211290 missense probably benign 0.02
R6264:Dedd2 UTSW 7 25203790 missense possibly damaging 0.84
R6733:Dedd2 UTSW 7 25203907 missense probably benign 0.30
R7267:Dedd2 UTSW 7 25218966 missense probably damaging 0.99
R8465:Dedd2 UTSW 7 25218906 missense probably damaging 0.99
Z1176:Dedd2 UTSW 7 25203598 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGTCCTCAAGCTGCTGAATGTC -3'
(R):5'- CTGGATGTGTTTGGACAAGC -3'

Sequencing Primer
(F):5'- AATGTCAGACGTCTGGGGGC -3'
(R):5'- TCAAGGGACCTGGGCTCTG -3'
Posted On2018-07-24