Mutagenetix > Incidental Mutations

Incidental Mutation 'R6646:Synm'

527974

Institutional Source

Beutler Lab

Gene Symbol

Synm

Ensembl Gene

ENSMUSG00000030554

Gene Name

synemin, intermediate filament protein

Synonyms

4930412K21Rik, Dmn, Synemin

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6646 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

67730160-67759742 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 67735127 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Lysine at position 487 (I487K)

Ref Sequence

ENSEMBL: ENSMUSP00000146510 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000051389] [ENSMUST00000074233] [ENSMUST00000207102] [ENSMUST00000208231] [ENSMUST00000208815]

Predicted Effect

probably damaging
Transcript: ENSMUST00000051389
AA Change: I929K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000050987
Gene: ENSMUSG00000030554
AA Change: I929K

Domain	Start	End	E-Value	Type
Pfam:Filament	10	321	2.7e-38	PFAM
low complexity region	1248	1257	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000074233
AA Change: I929K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000073855
Gene: ENSMUSG00000030554
AA Change: I929K

Domain	Start	End	E-Value	Type
Filament	10	321	6.4e-38	SMART
internal_repeat_1	1089	1185	3.03e-7	PROSPERO
internal_repeat_1	1351	1454	3.03e-7	PROSPERO
low complexity region	1550	1559	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000207102
AA Change: I487K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000208231

Predicted Effect

probably benign
Transcript: ENSMUST00000208764

Predicted Effect

probably benign
Transcript: ENSMUST00000208815

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.6%
20x: 92.4%

Validation Efficiency

100% (41/41)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an intermediate filament (IF) family member. IF proteins are cytoskeletal proteins that confer resistance to mechanical stress and are encoded by a dispersed multigene family. This protein has been found to form a linkage between desmin, which is a subunit of the IF network, and the extracellular matrix, and provides an important structural support in muscle. Two alternatively spliced variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a mild skeletal muscle phenotype characterized by abnormal muscle fiber morphology and increased sarcolemmal deformability and susceptibility to injury. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932415D10Rik	T	A	10: 82,296,830	E115D	unknown	Het
Ada	G	T	2: 163,735,423	N48K	probably benign	Het
Aldh1a7	C	T	19: 20,699,911	A449T	possibly damaging	Het
Arhgef28	A	G	13: 97,939,494	V1344A	probably benign	Het
Carmil3	A	T	14: 55,507,930	E1371D	probably damaging	Het
Crebbp	C	T	16: 4,119,806	A698T	possibly damaging	Het
Dedd2	T	C	7: 25,203,613	D307G	probably damaging	Het
Dennd6b	G	T	15: 89,186,184	F427L	probably damaging	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Homo
Doc2a	G	A	7: 126,851,619		probably null	Het
Dst	A	G	1: 34,268,807	T6503A	possibly damaging	Het
Ehmt1	A	T	2: 24,806,310	I922K	probably damaging	Het
Gbp9	A	G	5: 105,082,903	I385T	probably benign	Het
Gipc2	A	T	3: 152,094,201	D297E	possibly damaging	Het
Krt6b	T	A	15: 101,677,214	Q428L	probably damaging	Het
Loxl4	T	C	19: 42,598,781	D625G	probably damaging	Het
Lrrn2	C	T	1: 132,939,056	P620S	probably benign	Het
Msh6	T	C	17: 87,986,442	V875A	possibly damaging	Het
Nebl	T	C	2: 17,376,685	T727A	probably damaging	Het
Obscn	T	C	11: 59,082,718	D1929G	possibly damaging	Het
Pard3b	T	C	1: 62,161,121	V273A	probably benign	Het
Pcdhb7	T	A	18: 37,343,974	V721E	possibly damaging	Het
Plaa	A	T	4: 94,589,978	H82Q	probably benign	Het
Plcd1	T	A	9: 119,075,032	Y278F	probably damaging	Het
Plxnb1	C	A	9: 109,108,827	H1214N	probably benign	Het
Ptprg	C	A	14: 11,962,714	P171T	probably damaging	Het
Rela	T	G	19: 5,647,104	D446E	probably damaging	Het
Rpap1	T	C	2: 119,780,131	I156V	probably benign	Het
Rpl15	T	C	14: 18,270,040	Y59C	probably damaging	Het
Scx	C	A	15: 76,457,921	T107N	probably damaging	Het
Skint5	T	A	4: 113,940,777	K203I	possibly damaging	Het
Slc16a6	C	T	11: 109,453,162	M518I	probably benign	Het
Sorbs1	C	T	19: 40,325,549	G940R	probably damaging	Het
Tcerg1l	A	T	7: 138,395,183		probably null	Het
Vmn2r99	T	G	17: 19,380,031	L439R	probably damaging	Het
Wdr75	T	A	1: 45,799,087	L52Q	probably damaging	Het
Zswim2	T	A	2: 83,915,784	R437*	probably null	Het

Other mutations in Synm

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00161:Synm	APN	7	67734915	missense	probably benign	0.01
IGL01567:Synm	APN	7	67735232	missense	probably damaging	0.99
IGL01867:Synm	APN	7	67733474	missense	probably benign	0.13
IGL01870:Synm	APN	7	67736118	missense	possibly damaging	0.86
IGL01951:Synm	APN	7	67739137	missense	probably damaging	1.00
IGL02264:Synm	APN	7	67734396	missense	probably damaging	0.99
IGL02892:Synm	APN	7	67735056	missense	probably damaging	1.00
PIT4449001:Synm	UTSW	7	67735277	missense	probably benign
R0032:Synm	UTSW	7	67733927	missense	possibly damaging	0.90
R0194:Synm	UTSW	7	67734924	missense	probably damaging	1.00
R0345:Synm	UTSW	7	67735821	missense	probably benign	0.13
R0453:Synm	UTSW	7	67736882	missense	possibly damaging	0.92
R0646:Synm	UTSW	7	67759168	missense	probably benign	0.07
R0847:Synm	UTSW	7	67735056	missense	probably damaging	1.00
R0919:Synm	UTSW	7	67735347	missense	probably damaging	1.00
R1484:Synm	UTSW	7	67736332	missense	probably damaging	1.00
R1700:Synm	UTSW	7	67759628	start codon destroyed	probably null	0.98
R1715:Synm	UTSW	7	67736303	missense	probably damaging	1.00
R1796:Synm	UTSW	7	67734000	missense	possibly damaging	0.77
R1799:Synm	UTSW	7	67735959	missense	probably damaging	1.00
R2116:Synm	UTSW	7	67733595	missense	probably benign	0.18
R2979:Synm	UTSW	7	67736260	missense	probably damaging	1.00
R4116:Synm	UTSW	7	67734657	missense	possibly damaging	0.50
R4172:Synm	UTSW	7	67735361	missense	probably damaging	1.00
R4981:Synm	UTSW	7	67734487	missense	probably benign	0.02
R5114:Synm	UTSW	7	67735658	missense	probably damaging	1.00
R5276:Synm	UTSW	7	67734689	missense	probably benign	0.08
R5446:Synm	UTSW	7	67735974	missense	probably benign	0.17
R5592:Synm	UTSW	7	67759516	missense	probably damaging	1.00
R5960:Synm	UTSW	7	67735746	missense	probably damaging	1.00
R6025:Synm	UTSW	7	67734938	missense	possibly damaging	0.78
R6034:Synm	UTSW	7	67734905	missense	probably damaging	1.00
R6034:Synm	UTSW	7	67734905	missense	probably damaging	1.00
R6445:Synm	UTSW	7	67733645	missense	probably benign
R6446:Synm	UTSW	7	67734966	missense	probably damaging	1.00
R6492:Synm	UTSW	7	67736061	missense	probably benign	0.00
R6526:Synm	UTSW	7	67735583	missense	possibly damaging	0.62
R6612:Synm	UTSW	7	67733516	missense	probably damaging	0.99
R6708:Synm	UTSW	7	67733246	missense	possibly damaging	0.72
R6957:Synm	UTSW	7	67736100	missense	probably benign	0.28
R6988:Synm	UTSW	7	67733658	missense	probably damaging	1.00
R7208:Synm	UTSW	7	67734915	missense	probably benign	0.01
R7320:Synm	UTSW	7	67735380	missense	possibly damaging	0.89
R7417:Synm	UTSW	7	67733206	makesense	probably null
R7425:Synm	UTSW	7	67733446	missense	probably damaging	0.99
R7468:Synm	UTSW	7	67733223	missense	unknown
R7733:Synm	UTSW	7	67735945	splice site	probably null
R7782:Synm	UTSW	7	67734966	missense	probably damaging	1.00
R7826:Synm	UTSW	7	67735589	missense	probably damaging	1.00
R7971:Synm	UTSW	7	67735235	missense	possibly damaging	0.74
R8177:Synm	UTSW	7	67734065	missense	probably benign	0.00
R8190:Synm	UTSW	7	67733906	missense	probably benign
R8225:Synm	UTSW	7	67759049	missense	probably benign	0.16
R8414:Synm	UTSW	7	67733763	missense	probably benign	0.12
Z1088:Synm	UTSW	7	67751886	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGCGCTCTGGACTTTCTTTACG -3'
(R):5'- GTCTACCATCCGGTACTCATGG -3'

Sequencing Primer
(F):5'- GGACTTTCTTTACGTCCACAGAAACG -3'
(R):5'- ATCCGGTACTCATGGCAAGACG -3'

Posted On

2018-07-24