Incidental Mutation 'R6646:Doc2a'
ID527975
Institutional Source Beutler Lab
Gene Symbol Doc2a
Ensembl Gene ENSMUSG00000052301
Gene Namedouble C2, alpha
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R6646 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location126847416-126852705 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 126851619 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000070119 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050833] [ENSMUST00000064110] [ENSMUST00000106342] [ENSMUST00000106343] [ENSMUST00000137873] [ENSMUST00000139174] [ENSMUST00000141805] [ENSMUST00000147257] [ENSMUST00000152051] [ENSMUST00000206349] [ENSMUST00000206968] [ENSMUST00000205938]
Predicted Effect probably benign
Transcript: ENSMUST00000050833
SMART Domains Protein: ENSMUSP00000049851
Gene: ENSMUSG00000030689

DomainStartEndE-ValueType
low complexity region 25 42 N/A INTRINSIC
low complexity region 59 81 N/A INTRINSIC
low complexity region 86 108 N/A INTRINSIC
low complexity region 116 132 N/A INTRINSIC
low complexity region 163 171 N/A INTRINSIC
low complexity region 184 199 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000064110
SMART Domains Protein: ENSMUSP00000070119
Gene: ENSMUSG00000052301

DomainStartEndE-ValueType
Blast:C2 8 37 2e-10 BLAST
low complexity region 40 56 N/A INTRINSIC
low complexity region 57 78 N/A INTRINSIC
C2 110 215 1.68e-22 SMART
low complexity region 223 234 N/A INTRINSIC
C2 272 386 2.44e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106342
SMART Domains Protein: ENSMUSP00000101949
Gene: ENSMUSG00000030689

DomainStartEndE-ValueType
low complexity region 44 66 N/A INTRINSIC
low complexity region 74 90 N/A INTRINSIC
low complexity region 121 129 N/A INTRINSIC
low complexity region 142 157 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106343
SMART Domains Protein: ENSMUSP00000101950
Gene: ENSMUSG00000030689

DomainStartEndE-ValueType
coiled coil region 10 55 N/A INTRINSIC
low complexity region 64 81 N/A INTRINSIC
low complexity region 98 120 N/A INTRINSIC
low complexity region 125 147 N/A INTRINSIC
low complexity region 155 171 N/A INTRINSIC
low complexity region 202 210 N/A INTRINSIC
low complexity region 223 238 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125624
Predicted Effect probably benign
Transcript: ENSMUST00000137873
SMART Domains Protein: ENSMUSP00000119779
Gene: ENSMUSG00000052301

DomainStartEndE-ValueType
Blast:C2 8 37 1e-11 BLAST
low complexity region 40 56 N/A INTRINSIC
low complexity region 57 78 N/A INTRINSIC
C2 110 175 1.44e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000139174
SMART Domains Protein: ENSMUSP00000117376
Gene: ENSMUSG00000052301

DomainStartEndE-ValueType
Blast:C2 8 37 2e-12 BLAST
low complexity region 40 56 N/A INTRINSIC
low complexity region 57 78 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141805
SMART Domains Protein: ENSMUSP00000118143
Gene: ENSMUSG00000052301

DomainStartEndE-ValueType
Blast:C2 8 37 5e-12 BLAST
low complexity region 40 56 N/A INTRINSIC
low complexity region 57 78 N/A INTRINSIC
SCOP:d1rsy__ 81 134 1e-10 SMART
PDB:4MJJ|A 86 134 6e-26 PDB
Blast:C2 110 134 5e-10 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000147257
SMART Domains Protein: ENSMUSP00000123143
Gene: ENSMUSG00000052301

DomainStartEndE-ValueType
Blast:C2 8 37 2e-12 BLAST
low complexity region 40 56 N/A INTRINSIC
low complexity region 57 78 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000152051
SMART Domains Protein: ENSMUSP00000123483
Gene: ENSMUSG00000052301

DomainStartEndE-ValueType
Blast:C2 8 37 6e-11 BLAST
low complexity region 40 56 N/A INTRINSIC
low complexity region 57 78 N/A INTRINSIC
C2 110 215 1.68e-22 SMART
low complexity region 223 234 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152406
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153764
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154881
Predicted Effect probably benign
Transcript: ENSMUST00000176771
Predicted Effect probably benign
Transcript: ENSMUST00000205619
Predicted Effect probably benign
Transcript: ENSMUST00000206090
Predicted Effect probably benign
Transcript: ENSMUST00000206349
Predicted Effect probably benign
Transcript: ENSMUST00000205958
Predicted Effect probably benign
Transcript: ENSMUST00000206968
Predicted Effect probably benign
Transcript: ENSMUST00000205938
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.4%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] There are at least two protein isoforms of the Double C2 protein, namely alpha (DOC2A) and beta (DOC2B), which contain two C2-like domains. DOC2A and DOC2B are encoded by different genes; these genes are at times confused with the unrelated DAB2 gene which was initially named DOC-2. DOC2A is mainly expressed in brain and is suggested to be involved in Ca(2+)-dependent neurotransmitter release. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
PHENOTYPE: Homozygous inactivation of this locus affects excitatory synaptic transmission, LTP, and learning/memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T A 10: 82,296,830 E115D unknown Het
Ada G T 2: 163,735,423 N48K probably benign Het
Aldh1a7 C T 19: 20,699,911 A449T possibly damaging Het
Arhgef28 A G 13: 97,939,494 V1344A probably benign Het
Carmil3 A T 14: 55,507,930 E1371D probably damaging Het
Crebbp C T 16: 4,119,806 A698T possibly damaging Het
Dedd2 T C 7: 25,203,613 D307G probably damaging Het
Dennd6b G T 15: 89,186,184 F427L probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Dst A G 1: 34,268,807 T6503A possibly damaging Het
Ehmt1 A T 2: 24,806,310 I922K probably damaging Het
Gbp9 A G 5: 105,082,903 I385T probably benign Het
Gipc2 A T 3: 152,094,201 D297E possibly damaging Het
Krt6b T A 15: 101,677,214 Q428L probably damaging Het
Loxl4 T C 19: 42,598,781 D625G probably damaging Het
Lrrn2 C T 1: 132,939,056 P620S probably benign Het
Msh6 T C 17: 87,986,442 V875A possibly damaging Het
Nebl T C 2: 17,376,685 T727A probably damaging Het
Obscn T C 11: 59,082,718 D1929G possibly damaging Het
Pard3b T C 1: 62,161,121 V273A probably benign Het
Pcdhb7 T A 18: 37,343,974 V721E possibly damaging Het
Plaa A T 4: 94,589,978 H82Q probably benign Het
Plcd1 T A 9: 119,075,032 Y278F probably damaging Het
Plxnb1 C A 9: 109,108,827 H1214N probably benign Het
Ptprg C A 14: 11,962,714 P171T probably damaging Het
Rela T G 19: 5,647,104 D446E probably damaging Het
Rpap1 T C 2: 119,780,131 I156V probably benign Het
Rpl15 T C 14: 18,270,040 Y59C probably damaging Het
Scx C A 15: 76,457,921 T107N probably damaging Het
Skint5 T A 4: 113,940,777 K203I possibly damaging Het
Slc16a6 C T 11: 109,453,162 M518I probably benign Het
Sorbs1 C T 19: 40,325,549 G940R probably damaging Het
Synm A T 7: 67,735,127 I487K probably damaging Het
Tcerg1l A T 7: 138,395,183 probably null Het
Vmn2r99 T G 17: 19,380,031 L439R probably damaging Het
Wdr75 T A 1: 45,799,087 L52Q probably damaging Het
Zswim2 T A 2: 83,915,784 R437* probably null Het
Other mutations in Doc2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01287:Doc2a APN 7 126851001 missense probably damaging 1.00
R0423:Doc2a UTSW 7 126848658 missense probably damaging 1.00
R0538:Doc2a UTSW 7 126848811 missense probably benign 0.15
R1922:Doc2a UTSW 7 126851431 missense probably damaging 1.00
R1992:Doc2a UTSW 7 126851807 critical splice donor site probably null
R2402:Doc2a UTSW 7 126848747 nonsense probably null
R4344:Doc2a UTSW 7 126851149 missense probably damaging 1.00
R4644:Doc2a UTSW 7 126851446 missense probably benign 0.02
R4741:Doc2a UTSW 7 126851445 missense possibly damaging 0.48
R4932:Doc2a UTSW 7 126848580 unclassified probably benign
R5926:Doc2a UTSW 7 126849525 missense probably damaging 1.00
R8058:Doc2a UTSW 7 126850992 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- AACGGCTACTCTGACCCTTATG -3'
(R):5'- TCTGCCACTCACCTATGAAGTC -3'

Sequencing Primer
(F):5'- ACTCTGACCCTTATGTGAAGACGTG -3'
(R):5'- CAATGTCGTAGTCCCAGA -3'
Posted On2018-07-24