Incidental Mutation 'R6646:Tcerg1l'
ID527976
Institutional Source Beutler Lab
Gene Symbol Tcerg1l
Ensembl Gene ENSMUSG00000091002
Gene Nametranscription elongation regulator 1-like
Synonyms5730476P14Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6646 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location138208974-138397730 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 138395183 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000124476 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000160436] [ENSMUST00000160436] [ENSMUST00000160436]
Predicted Effect probably null
Transcript: ENSMUST00000160436
SMART Domains Protein: ENSMUSP00000124476
Gene: ENSMUSG00000091002

DomainStartEndE-ValueType
low complexity region 6 44 N/A INTRINSIC
low complexity region 52 97 N/A INTRINSIC
WW 146 178 2.11e1 SMART
low complexity region 235 249 N/A INTRINSIC
WW 344 376 3.29e-4 SMART
low complexity region 402 415 N/A INTRINSIC
FF 454 507 4.57e-12 SMART
FF 520 574 1.53e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000160436
SMART Domains Protein: ENSMUSP00000124476
Gene: ENSMUSG00000091002

DomainStartEndE-ValueType
low complexity region 6 44 N/A INTRINSIC
low complexity region 52 97 N/A INTRINSIC
WW 146 178 2.11e1 SMART
low complexity region 235 249 N/A INTRINSIC
WW 344 376 3.29e-4 SMART
low complexity region 402 415 N/A INTRINSIC
FF 454 507 4.57e-12 SMART
FF 520 574 1.53e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000160436
SMART Domains Protein: ENSMUSP00000124476
Gene: ENSMUSG00000091002

DomainStartEndE-ValueType
low complexity region 6 44 N/A INTRINSIC
low complexity region 52 97 N/A INTRINSIC
WW 146 178 2.11e1 SMART
low complexity region 235 249 N/A INTRINSIC
WW 344 376 3.29e-4 SMART
low complexity region 402 415 N/A INTRINSIC
FF 454 507 4.57e-12 SMART
FF 520 574 1.53e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162222
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.4%
Validation Efficiency 100% (41/41)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T A 10: 82,296,830 E115D unknown Het
Ada G T 2: 163,735,423 N48K probably benign Het
Aldh1a7 C T 19: 20,699,911 A449T possibly damaging Het
Arhgef28 A G 13: 97,939,494 V1344A probably benign Het
Carmil3 A T 14: 55,507,930 E1371D probably damaging Het
Crebbp C T 16: 4,119,806 A698T possibly damaging Het
Dedd2 T C 7: 25,203,613 D307G probably damaging Het
Dennd6b G T 15: 89,186,184 F427L probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Doc2a G A 7: 126,851,619 probably null Het
Dst A G 1: 34,268,807 T6503A possibly damaging Het
Ehmt1 A T 2: 24,806,310 I922K probably damaging Het
Gbp9 A G 5: 105,082,903 I385T probably benign Het
Gipc2 A T 3: 152,094,201 D297E possibly damaging Het
Krt6b T A 15: 101,677,214 Q428L probably damaging Het
Loxl4 T C 19: 42,598,781 D625G probably damaging Het
Lrrn2 C T 1: 132,939,056 P620S probably benign Het
Msh6 T C 17: 87,986,442 V875A possibly damaging Het
Nebl T C 2: 17,376,685 T727A probably damaging Het
Obscn T C 11: 59,082,718 D1929G possibly damaging Het
Pard3b T C 1: 62,161,121 V273A probably benign Het
Pcdhb7 T A 18: 37,343,974 V721E possibly damaging Het
Plaa A T 4: 94,589,978 H82Q probably benign Het
Plcd1 T A 9: 119,075,032 Y278F probably damaging Het
Plxnb1 C A 9: 109,108,827 H1214N probably benign Het
Ptprg C A 14: 11,962,714 P171T probably damaging Het
Rela T G 19: 5,647,104 D446E probably damaging Het
Rpap1 T C 2: 119,780,131 I156V probably benign Het
Rpl15 T C 14: 18,270,040 Y59C probably damaging Het
Scx C A 15: 76,457,921 T107N probably damaging Het
Skint5 T A 4: 113,940,777 K203I possibly damaging Het
Slc16a6 C T 11: 109,453,162 M518I probably benign Het
Sorbs1 C T 19: 40,325,549 G940R probably damaging Het
Synm A T 7: 67,735,127 I487K probably damaging Het
Vmn2r99 T G 17: 19,380,031 L439R probably damaging Het
Wdr75 T A 1: 45,799,087 L52Q probably damaging Het
Zswim2 T A 2: 83,915,784 R437* probably null Het
Other mutations in Tcerg1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Tcerg1l APN 7 138209804 missense probably damaging 0.99
IGL01402:Tcerg1l APN 7 138259839 missense probably damaging 0.98
IGL01510:Tcerg1l APN 7 138394305 splice site probably benign
IGL01638:Tcerg1l APN 7 138280076 missense probably damaging 1.00
IGL01710:Tcerg1l APN 7 138395060 missense possibly damaging 0.81
IGL02547:Tcerg1l APN 7 138248371 critical splice donor site probably null
IGL02887:Tcerg1l APN 7 138229890 missense probably damaging 1.00
IGL03105:Tcerg1l APN 7 138248444 splice site probably benign
IGL03348:Tcerg1l APN 7 138213371 missense probably damaging 0.97
R0378:Tcerg1l UTSW 7 138276655 missense probably benign 0.01
R1474:Tcerg1l UTSW 7 138280075 missense probably damaging 0.99
R1589:Tcerg1l UTSW 7 138361767 missense probably damaging 0.99
R1658:Tcerg1l UTSW 7 138394180 missense probably damaging 0.98
R1792:Tcerg1l UTSW 7 138361866 missense probably benign 0.07
R1807:Tcerg1l UTSW 7 138395097 missense probably benign 0.34
R2920:Tcerg1l UTSW 7 138248379 missense probably damaging 0.99
R3148:Tcerg1l UTSW 7 138259867 missense probably benign
R4106:Tcerg1l UTSW 7 138259944 missense probably damaging 0.99
R4180:Tcerg1l UTSW 7 138276676 critical splice acceptor site probably null
R4241:Tcerg1l UTSW 7 138397632 missense unknown
R4898:Tcerg1l UTSW 7 138218057 missense probably damaging 0.99
R5652:Tcerg1l UTSW 7 138280046 missense probably damaging 0.97
R6824:Tcerg1l UTSW 7 138394115 critical splice donor site probably null
R7414:Tcerg1l UTSW 7 138218057 missense probably damaging 0.97
R7490:Tcerg1l UTSW 7 138259828 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGTTAACATGGTGATACCCAGC -3'
(R):5'- GTCTCTCATGGTCTTATCTTGGAAG -3'

Sequencing Primer
(F):5'- ACTTATCCAATTAAATCCCTTGCAC -3'
(R):5'- CATGGTCTTATCTTGGAAGTTCTTTC -3'
Posted On2018-07-24