Mutagenetix > Incidental Mutations

Incidental Mutation 'R6646:Tcerg1l'

527976

Institutional Source

Beutler Lab

Gene Symbol

Tcerg1l

Ensembl Gene

ENSMUSG00000091002

Gene Name

transcription elongation regulator 1-like

Synonyms

5730476P14Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6646 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

138208974-138397730 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to T at 138395183 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000124476 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000160436] [ENSMUST00000160436] [ENSMUST00000160436]

Predicted Effect

probably null
Transcript: ENSMUST00000160436

SMART Domains

Protein: ENSMUSP00000124476
Gene: ENSMUSG00000091002

Domain	Start	End	E-Value	Type
low complexity region	6	44	N/A	INTRINSIC
low complexity region	52	97	N/A	INTRINSIC
WW	146	178	2.11e1	SMART
low complexity region	235	249	N/A	INTRINSIC
WW	344	376	3.29e-4	SMART
low complexity region	402	415	N/A	INTRINSIC
FF	454	507	4.57e-12	SMART
FF	520	574	1.53e-4	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000160436

SMART Domains

Protein: ENSMUSP00000124476
Gene: ENSMUSG00000091002

Domain	Start	End	E-Value	Type
low complexity region	6	44	N/A	INTRINSIC
low complexity region	52	97	N/A	INTRINSIC
WW	146	178	2.11e1	SMART
low complexity region	235	249	N/A	INTRINSIC
WW	344	376	3.29e-4	SMART
low complexity region	402	415	N/A	INTRINSIC
FF	454	507	4.57e-12	SMART
FF	520	574	1.53e-4	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000160436

SMART Domains

Protein: ENSMUSP00000124476
Gene: ENSMUSG00000091002

Domain	Start	End	E-Value	Type
low complexity region	6	44	N/A	INTRINSIC
low complexity region	52	97	N/A	INTRINSIC
WW	146	178	2.11e1	SMART
low complexity region	235	249	N/A	INTRINSIC
WW	344	376	3.29e-4	SMART
low complexity region	402	415	N/A	INTRINSIC
FF	454	507	4.57e-12	SMART
FF	520	574	1.53e-4	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162222

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.6%
20x: 92.4%

Validation Efficiency

100% (41/41)

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932415D10Rik	T	A	10: 82,296,830	E115D	unknown	Het
Ada	G	T	2: 163,735,423	N48K	probably benign	Het
Aldh1a7	C	T	19: 20,699,911	A449T	possibly damaging	Het
Arhgef28	A	G	13: 97,939,494	V1344A	probably benign	Het
Carmil3	A	T	14: 55,507,930	E1371D	probably damaging	Het
Crebbp	C	T	16: 4,119,806	A698T	possibly damaging	Het
Dedd2	T	C	7: 25,203,613	D307G	probably damaging	Het
Dennd6b	G	T	15: 89,186,184	F427L	probably damaging	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Homo
Doc2a	G	A	7: 126,851,619		probably null	Het
Dst	A	G	1: 34,268,807	T6503A	possibly damaging	Het
Ehmt1	A	T	2: 24,806,310	I922K	probably damaging	Het
Gbp9	A	G	5: 105,082,903	I385T	probably benign	Het
Gipc2	A	T	3: 152,094,201	D297E	possibly damaging	Het
Krt6b	T	A	15: 101,677,214	Q428L	probably damaging	Het
Loxl4	T	C	19: 42,598,781	D625G	probably damaging	Het
Lrrn2	C	T	1: 132,939,056	P620S	probably benign	Het
Msh6	T	C	17: 87,986,442	V875A	possibly damaging	Het
Nebl	T	C	2: 17,376,685	T727A	probably damaging	Het
Obscn	T	C	11: 59,082,718	D1929G	possibly damaging	Het
Pard3b	T	C	1: 62,161,121	V273A	probably benign	Het
Pcdhb7	T	A	18: 37,343,974	V721E	possibly damaging	Het
Plaa	A	T	4: 94,589,978	H82Q	probably benign	Het
Plcd1	T	A	9: 119,075,032	Y278F	probably damaging	Het
Plxnb1	C	A	9: 109,108,827	H1214N	probably benign	Het
Ptprg	C	A	14: 11,962,714	P171T	probably damaging	Het
Rela	T	G	19: 5,647,104	D446E	probably damaging	Het
Rpap1	T	C	2: 119,780,131	I156V	probably benign	Het
Rpl15	T	C	14: 18,270,040	Y59C	probably damaging	Het
Scx	C	A	15: 76,457,921	T107N	probably damaging	Het
Skint5	T	A	4: 113,940,777	K203I	possibly damaging	Het
Slc16a6	C	T	11: 109,453,162	M518I	probably benign	Het
Sorbs1	C	T	19: 40,325,549	G940R	probably damaging	Het
Synm	A	T	7: 67,735,127	I487K	probably damaging	Het
Vmn2r99	T	G	17: 19,380,031	L439R	probably damaging	Het
Wdr75	T	A	1: 45,799,087	L52Q	probably damaging	Het
Zswim2	T	A	2: 83,915,784	R437*	probably null	Het

Other mutations in Tcerg1l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00504:Tcerg1l	APN	7	138209804	missense	probably damaging	0.99
IGL01402:Tcerg1l	APN	7	138259839	missense	probably damaging	0.98
IGL01510:Tcerg1l	APN	7	138394305	splice site	probably benign
IGL01638:Tcerg1l	APN	7	138280076	missense	probably damaging	1.00
IGL01710:Tcerg1l	APN	7	138395060	missense	possibly damaging	0.81
IGL02547:Tcerg1l	APN	7	138248371	critical splice donor site	probably null
IGL02887:Tcerg1l	APN	7	138229890	missense	probably damaging	1.00
IGL03105:Tcerg1l	APN	7	138248444	splice site	probably benign
IGL03348:Tcerg1l	APN	7	138213371	missense	probably damaging	0.97
R0378:Tcerg1l	UTSW	7	138276655	missense	probably benign	0.01
R1474:Tcerg1l	UTSW	7	138280075	missense	probably damaging	0.99
R1589:Tcerg1l	UTSW	7	138361767	missense	probably damaging	0.99
R1658:Tcerg1l	UTSW	7	138394180	missense	probably damaging	0.98
R1792:Tcerg1l	UTSW	7	138361866	missense	probably benign	0.07
R1807:Tcerg1l	UTSW	7	138395097	missense	probably benign	0.34
R2920:Tcerg1l	UTSW	7	138248379	missense	probably damaging	0.99
R3148:Tcerg1l	UTSW	7	138259867	missense	probably benign
R4106:Tcerg1l	UTSW	7	138259944	missense	probably damaging	0.99
R4180:Tcerg1l	UTSW	7	138276676	critical splice acceptor site	probably null
R4241:Tcerg1l	UTSW	7	138397632	missense	unknown
R4898:Tcerg1l	UTSW	7	138218057	missense	probably damaging	0.99
R5652:Tcerg1l	UTSW	7	138280046	missense	probably damaging	0.97
R6824:Tcerg1l	UTSW	7	138394115	critical splice donor site	probably null
R7414:Tcerg1l	UTSW	7	138218057	missense	probably damaging	0.97
R7490:Tcerg1l	UTSW	7	138259828	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTGTTAACATGGTGATACCCAGC -3'
(R):5'- GTCTCTCATGGTCTTATCTTGGAAG -3'

Sequencing Primer
(F):5'- ACTTATCCAATTAAATCCCTTGCAC -3'
(R):5'- CATGGTCTTATCTTGGAAGTTCTTTC -3'

Posted On

2018-07-24