Mutagenetix > Incidental Mutations

Incidental Mutation 'R6646:Plcd1'

527978

Institutional Source

Beutler Lab

Gene Symbol

Plcd1

Ensembl Gene

ENSMUSG00000010660

Gene Name

phospholipase C, delta 1

Synonyms

PLC-delta 1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.380) question?

Stock #

R6646 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

119071527-119093502 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 119075032 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Phenylalanine at position 278 (Y278F)

Ref Sequence

ENSEMBL: ENSMUSP00000149676 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000010804] [ENSMUST00000051386] [ENSMUST00000074734] [ENSMUST00000126251] [ENSMUST00000141185] [ENSMUST00000213464] [ENSMUST00000214470]

Predicted Effect

probably benign
Transcript: ENSMUST00000010804
AA Change: Y278F

PolyPhen 2 Score 0.438 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000010804
Gene: ENSMUSG00000010660
AA Change: Y278F

Domain	Start	End	E-Value	Type
PH	22	132	9.41e-10	SMART
EFh	144	172	2.87e-2	SMART
EFh	180	208	9.34e1	SMART
Pfam:EF-hand_like	213	295	1.2e-23	PFAM
PLCXc	296	440	5.47e-94	SMART
low complexity region	461	472	N/A	INTRINSIC
PLCYc	492	609	1.22e-68	SMART
C2	630	735	1.78e-21	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000051386

SMART Domains

Protein: ENSMUSP00000061731
Gene: ENSMUSG00000038775

Domain	Start	End	E-Value	Type
GEL	14	114	4.59e-13	SMART
GEL	135	227	4.18e-16	SMART
GEL	252	348	8.35e-25	SMART
GEL	391	488	7.92e-17	SMART
GEL	508	594	4.38e-19	SMART
GEL	613	706	7.8e-16	SMART
VHP	824	859	2.12e-17	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000074734

SMART Domains

Protein: ENSMUSP00000074294
Gene: ENSMUSG00000038775

Domain	Start	End	E-Value	Type
GEL	14	114	4.59e-13	SMART
GEL	135	227	4.18e-16	SMART
GEL	252	348	8.35e-25	SMART
GEL	391	488	7.92e-17	SMART
GEL	508	594	4.38e-19	SMART
VHP	740	775	2.12e-17	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000126251

SMART Domains

Protein: ENSMUSP00000116262
Gene: ENSMUSG00000038775

Domain	Start	End	E-Value	Type
Blast:GEL	1	56	9e-21	BLAST
GEL	63	149	4.38e-19	SMART
GEL	168	261	7.8e-16	SMART
VHP	357	392	2.12e-17	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000141185

SMART Domains

Protein: ENSMUSP00000116546
Gene: ENSMUSG00000038775

Domain	Start	End	E-Value	Type
GEL	7	104	7.92e-17	SMART
GEL	124	210	4.38e-19	SMART
GEL	229	322	7.8e-16	SMART
VHP	440	475	2.12e-17	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153454

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153630

Predicted Effect

probably damaging
Transcript: ENSMUST00000213464
AA Change: Y278F

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

Predicted Effect

probably damaging
Transcript: ENSMUST00000214470
AA Change: Y304F

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000214491

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.6%
20x: 92.4%

Validation Efficiency

100% (41/41)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the phospholipase C family. Phospholipase C isozymes play critical roles in intracellular signal transduction by catalyzing the hydrolysis of phosphatidylinositol 4,5-bisphosphate (PIP2) into the second messengers diacylglycerol (DAG) and inositol triphosphate (IP3). The encoded protein functions as a tumor suppressor in several types of cancer, and mutations in this gene are a cause of hereditary leukonychia. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene show reduced body size and various abnormalities of the skin and hair including alopecia, epidermal hyperplasia, enlarged sebaceous glands, various kinds of cysts, and skin tumors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932415D10Rik	T	A	10: 82,296,830	E115D	unknown	Het
Ada	G	T	2: 163,735,423	N48K	probably benign	Het
Aldh1a7	C	T	19: 20,699,911	A449T	possibly damaging	Het
Arhgef28	A	G	13: 97,939,494	V1344A	probably benign	Het
Carmil3	A	T	14: 55,507,930	E1371D	probably damaging	Het
Crebbp	C	T	16: 4,119,806	A698T	possibly damaging	Het
Dedd2	T	C	7: 25,203,613	D307G	probably damaging	Het
Dennd6b	G	T	15: 89,186,184	F427L	probably damaging	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Homo
Doc2a	G	A	7: 126,851,619		probably null	Het
Dst	A	G	1: 34,268,807	T6503A	possibly damaging	Het
Ehmt1	A	T	2: 24,806,310	I922K	probably damaging	Het
Gbp9	A	G	5: 105,082,903	I385T	probably benign	Het
Gipc2	A	T	3: 152,094,201	D297E	possibly damaging	Het
Krt6b	T	A	15: 101,677,214	Q428L	probably damaging	Het
Loxl4	T	C	19: 42,598,781	D625G	probably damaging	Het
Lrrn2	C	T	1: 132,939,056	P620S	probably benign	Het
Msh6	T	C	17: 87,986,442	V875A	possibly damaging	Het
Nebl	T	C	2: 17,376,685	T727A	probably damaging	Het
Obscn	T	C	11: 59,082,718	D1929G	possibly damaging	Het
Pard3b	T	C	1: 62,161,121	V273A	probably benign	Het
Pcdhb7	T	A	18: 37,343,974	V721E	possibly damaging	Het
Plaa	A	T	4: 94,589,978	H82Q	probably benign	Het
Plxnb1	C	A	9: 109,108,827	H1214N	probably benign	Het
Ptprg	C	A	14: 11,962,714	P171T	probably damaging	Het
Rela	T	G	19: 5,647,104	D446E	probably damaging	Het
Rpap1	T	C	2: 119,780,131	I156V	probably benign	Het
Rpl15	T	C	14: 18,270,040	Y59C	probably damaging	Het
Scx	C	A	15: 76,457,921	T107N	probably damaging	Het
Skint5	T	A	4: 113,940,777	K203I	possibly damaging	Het
Slc16a6	C	T	11: 109,453,162	M518I	probably benign	Het
Sorbs1	C	T	19: 40,325,549	G940R	probably damaging	Het
Synm	A	T	7: 67,735,127	I487K	probably damaging	Het
Tcerg1l	A	T	7: 138,395,183		probably null	Het
Vmn2r99	T	G	17: 19,380,031	L439R	probably damaging	Het
Wdr75	T	A	1: 45,799,087	L52Q	probably damaging	Het
Zswim2	T	A	2: 83,915,784	R437*	probably null	Het

Other mutations in Plcd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01621:Plcd1	APN	9	119076178	missense	probably damaging	1.00
IGL01634:Plcd1	APN	9	119073789	missense	probably damaging	0.99
IGL01992:Plcd1	APN	9	119075985	missense	probably benign
IGL02246:Plcd1	APN	9	119072609	missense	probably benign	0.16
IGL02266:Plcd1	APN	9	119074787	splice site	probably benign
IGL02270:Plcd1	APN	9	119084641	missense	probably damaging	1.00
IGL02281:Plcd1	APN	9	119074773	missense	probably benign	0.00
IGL02324:Plcd1	APN	9	119072642	missense	probably damaging	0.97
IGL02936:Plcd1	APN	9	119074199	missense	probably damaging	1.00
IGL03348:Plcd1	APN	9	119072490	missense	possibly damaging	0.91
R0366:Plcd1	UTSW	9	119081136	missense	probably damaging	0.99
R1765:Plcd1	UTSW	9	119071806	missense	probably damaging	1.00
R3704:Plcd1	UTSW	9	119076209	missense	possibly damaging	0.85
R5143:Plcd1	UTSW	9	119074451	nonsense	probably null
R5587:Plcd1	UTSW	9	119073832	missense	probably benign
R5877:Plcd1	UTSW	9	119076172	missense	probably damaging	1.00
R6043:Plcd1	UTSW	9	119072599	missense	probably damaging	1.00
R6103:Plcd1	UTSW	9	119072041	missense	probably benign	0.16
R6338:Plcd1	UTSW	9	119074991	missense	probably damaging	1.00
R6339:Plcd1	UTSW	9	119074991	missense	probably damaging	1.00
R6496:Plcd1	UTSW	9	119072641	missense	possibly damaging	0.79
R6516:Plcd1	UTSW	9	119076203	missense	probably damaging	0.99
R6854:Plcd1	UTSW	9	119074321	splice site	probably null
R6955:Plcd1	UTSW	9	119071856	missense	probably benign	0.01
R7382:Plcd1	UTSW	9	119074691	missense	probably damaging	1.00
R7577:Plcd1	UTSW	9	119072254	missense	possibly damaging	0.94
R7922:Plcd1	UTSW	9	119074652	missense	possibly damaging	0.64
R8089:Plcd1	UTSW	9	119075992	missense	possibly damaging	0.95

Predicted Primers

PCR Primer
(F):5'- ACTAGGCTAAGACCCTCCAG -3'
(R):5'- GAGATCAGGACTTCTGCTCCTC -3'

Sequencing Primer
(F):5'- CTAACAGTTCCCTGGGCCG -3'
(R):5'- CTCAGAGCTGCAGAGGACTG -3'

Posted On

2018-07-24