Incidental Mutation 'R6646:Arhgef28'
ID527982
Institutional Source Beutler Lab
Gene Symbol Arhgef28
Ensembl Gene ENSMUSG00000021662
Gene NameRho guanine nucleotide exchange factor (GEF) 28
SynonymsRhoGEF, Rgnef, Rho specific exchange factor, p190RhoGEF, 9230110L08Rik, D13Bwg1089e, RIP2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6646 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location97899469-98206439 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 97939494 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1344 (V1344A)
Ref Sequence ENSEMBL: ENSMUSP00000105053 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109426] [ENSMUST00000225884]
Predicted Effect probably benign
Transcript: ENSMUST00000109426
AA Change: V1344A

PolyPhen 2 Score 0.095 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000105053
Gene: ENSMUSG00000021662
AA Change: V1344A

DomainStartEndE-ValueType
low complexity region 530 568 N/A INTRINSIC
low complexity region 634 650 N/A INTRINSIC
C1 652 698 1.65e-11 SMART
RhoGEF 850 1040 1.11e-65 SMART
PH 1084 1187 1.08e-9 SMART
low complexity region 1267 1281 N/A INTRINSIC
coiled coil region 1469 1522 N/A INTRINSIC
low complexity region 1647 1663 N/A INTRINSIC
low complexity region 1682 1693 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225269
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225663
Predicted Effect probably benign
Transcript: ENSMUST00000225884
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.4%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Rho guanine nucleotide exchange factor family. The encoded protein interacts with low molecular weight neurofilament mRNA and may be involved in the formation of amyotrophic lateral sclerosis neurofilament aggregates. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-out allele are born at lower than expected Mendelian ratios and exhibit a reduction in overall size that becomes negligible by 8 weeks of age. Mouse embryonic fibroblasts display defects in cell migration and focal adhesion formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T A 10: 82,296,830 E115D unknown Het
Ada G T 2: 163,735,423 N48K probably benign Het
Aldh1a7 C T 19: 20,699,911 A449T possibly damaging Het
Carmil3 A T 14: 55,507,930 E1371D probably damaging Het
Crebbp C T 16: 4,119,806 A698T possibly damaging Het
Dedd2 T C 7: 25,203,613 D307G probably damaging Het
Dennd6b G T 15: 89,186,184 F427L probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Doc2a G A 7: 126,851,619 probably null Het
Dst A G 1: 34,268,807 T6503A possibly damaging Het
Ehmt1 A T 2: 24,806,310 I922K probably damaging Het
Gbp9 A G 5: 105,082,903 I385T probably benign Het
Gipc2 A T 3: 152,094,201 D297E possibly damaging Het
Krt6b T A 15: 101,677,214 Q428L probably damaging Het
Loxl4 T C 19: 42,598,781 D625G probably damaging Het
Lrrn2 C T 1: 132,939,056 P620S probably benign Het
Msh6 T C 17: 87,986,442 V875A possibly damaging Het
Nebl T C 2: 17,376,685 T727A probably damaging Het
Obscn T C 11: 59,082,718 D1929G possibly damaging Het
Pard3b T C 1: 62,161,121 V273A probably benign Het
Pcdhb7 T A 18: 37,343,974 V721E possibly damaging Het
Plaa A T 4: 94,589,978 H82Q probably benign Het
Plcd1 T A 9: 119,075,032 Y278F probably damaging Het
Plxnb1 C A 9: 109,108,827 H1214N probably benign Het
Ptprg C A 14: 11,962,714 P171T probably damaging Het
Rela T G 19: 5,647,104 D446E probably damaging Het
Rpap1 T C 2: 119,780,131 I156V probably benign Het
Rpl15 T C 14: 18,270,040 Y59C probably damaging Het
Scx C A 15: 76,457,921 T107N probably damaging Het
Skint5 T A 4: 113,940,777 K203I possibly damaging Het
Slc16a6 C T 11: 109,453,162 M518I probably benign Het
Sorbs1 C T 19: 40,325,549 G940R probably damaging Het
Synm A T 7: 67,735,127 I487K probably damaging Het
Tcerg1l A T 7: 138,395,183 probably null Het
Vmn2r99 T G 17: 19,380,031 L439R probably damaging Het
Wdr75 T A 1: 45,799,087 L52Q probably damaging Het
Zswim2 T A 2: 83,915,784 R437* probably null Het
Other mutations in Arhgef28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00426:Arhgef28 APN 13 97988277 missense probably benign 0.15
IGL00945:Arhgef28 APN 13 97967399 missense possibly damaging 0.88
IGL01099:Arhgef28 APN 13 97953972 splice site probably benign
IGL01328:Arhgef28 APN 13 97970323 missense probably damaging 1.00
IGL01396:Arhgef28 APN 13 97953893 missense probably damaging 0.99
IGL02067:Arhgef28 APN 13 98077317 missense probably damaging 1.00
IGL02147:Arhgef28 APN 13 97961314 missense probably damaging 1.00
IGL02285:Arhgef28 APN 13 98051028 missense possibly damaging 0.85
IGL02439:Arhgef28 APN 13 97931139 missense possibly damaging 0.75
IGL02499:Arhgef28 APN 13 97953783 missense possibly damaging 0.87
IGL02532:Arhgef28 APN 13 98029883 missense probably damaging 0.99
IGL02634:Arhgef28 APN 13 98051058 missense probably benign 0.00
IGL02902:Arhgef28 APN 13 97946875 missense probably damaging 1.00
IGL03067:Arhgef28 APN 13 97988286 missense probably benign 0.00
IGL03081:Arhgef28 APN 13 98029373 splice site probably benign
IGL03106:Arhgef28 APN 13 97957793 missense probably damaging 1.00
IGL03195:Arhgef28 APN 13 97951563 splice site probably null
IGL03325:Arhgef28 APN 13 97899816 missense probably benign 0.03
H8786:Arhgef28 UTSW 13 97946953 missense probably damaging 1.00
R0027:Arhgef28 UTSW 13 97945696 missense possibly damaging 0.94
R0027:Arhgef28 UTSW 13 97945696 missense possibly damaging 0.94
R0062:Arhgef28 UTSW 13 97956642 missense possibly damaging 0.56
R0062:Arhgef28 UTSW 13 97956642 missense possibly damaging 0.56
R0090:Arhgef28 UTSW 13 98075110 missense probably damaging 0.99
R0096:Arhgef28 UTSW 13 97931254 missense probably damaging 1.00
R0096:Arhgef28 UTSW 13 97931254 missense probably damaging 1.00
R0537:Arhgef28 UTSW 13 97957716 missense probably damaging 1.00
R0617:Arhgef28 UTSW 13 97970355 missense probably benign 0.21
R0711:Arhgef28 UTSW 13 97931254 missense probably damaging 1.00
R0723:Arhgef28 UTSW 13 97939479 missense probably benign 0.16
R0790:Arhgef28 UTSW 13 97981406 missense possibly damaging 0.51
R1240:Arhgef28 UTSW 13 97929492 missense probably benign 0.00
R1365:Arhgef28 UTSW 13 98075124 missense probably damaging 1.00
R1456:Arhgef28 UTSW 13 98075002 missense probably benign 0.01
R1490:Arhgef28 UTSW 13 97978444 missense probably damaging 1.00
R1496:Arhgef28 UTSW 13 97965546 missense possibly damaging 0.93
R1660:Arhgef28 UTSW 13 97981376 missense probably benign 0.05
R1671:Arhgef28 UTSW 13 97931034 missense possibly damaging 0.95
R1747:Arhgef28 UTSW 13 97936824 missense probably damaging 1.00
R1792:Arhgef28 UTSW 13 97931186 missense probably benign 0.03
R1864:Arhgef28 UTSW 13 97994132 missense probably benign 0.00
R1887:Arhgef28 UTSW 13 98145573 missense probably damaging 0.97
R1924:Arhgef28 UTSW 13 97936816 splice site probably benign
R1987:Arhgef28 UTSW 13 97967096 missense probably benign
R2215:Arhgef28 UTSW 13 98051021 missense possibly damaging 0.78
R2342:Arhgef28 UTSW 13 97994029 missense probably benign 0.00
R2495:Arhgef28 UTSW 13 98029373 splice site probably benign
R3897:Arhgef28 UTSW 13 97956576 missense probably damaging 1.00
R3922:Arhgef28 UTSW 13 97993944 missense possibly damaging 0.92
R4063:Arhgef28 UTSW 13 97994067 missense probably benign 0.16
R4086:Arhgef28 UTSW 13 97967204 missense probably damaging 0.98
R4543:Arhgef28 UTSW 13 98075000 missense probably benign 0.00
R4730:Arhgef28 UTSW 13 97978142 missense probably benign 0.00
R4735:Arhgef28 UTSW 13 97899729 missense probably damaging 1.00
R4953:Arhgef28 UTSW 13 97929554 missense possibly damaging 0.51
R5069:Arhgef28 UTSW 13 98075206 missense probably damaging 0.96
R5558:Arhgef28 UTSW 13 97961460 missense probably damaging 1.00
R5573:Arhgef28 UTSW 13 97929491 missense probably benign 0.01
R5594:Arhgef28 UTSW 13 97939492 missense probably benign 0.00
R5937:Arhgef28 UTSW 13 97939543 missense probably benign 0.00
R5987:Arhgef28 UTSW 13 97936860 nonsense probably null
R6015:Arhgef28 UTSW 13 98075022 missense possibly damaging 0.73
R6193:Arhgef28 UTSW 13 97985380 missense probably damaging 1.00
R6209:Arhgef28 UTSW 13 97929409 critical splice donor site probably null
R6306:Arhgef28 UTSW 13 97985388 missense probably damaging 1.00
R6393:Arhgef28 UTSW 13 97994019 missense possibly damaging 0.64
R6562:Arhgef28 UTSW 13 97988139 critical splice donor site probably null
R6655:Arhgef28 UTSW 13 97899655 missense probably damaging 1.00
R6707:Arhgef28 UTSW 13 97936716 missense probably damaging 0.96
R6707:Arhgef28 UTSW 13 98075116 missense possibly damaging 0.80
R6751:Arhgef28 UTSW 13 98075247 missense probably damaging 0.97
R6940:Arhgef28 UTSW 13 97965530 missense possibly damaging 0.58
R7018:Arhgef28 UTSW 13 97965435 missense probably damaging 1.00
R7030:Arhgef28 UTSW 13 97988261 missense possibly damaging 0.88
R7120:Arhgef28 UTSW 13 97944539 missense probably damaging 1.00
R7266:Arhgef28 UTSW 13 97965452 missense probably benign
R7353:Arhgef28 UTSW 13 98075202 missense probably damaging 1.00
R7368:Arhgef28 UTSW 13 97996862 missense probably benign 0.34
R7491:Arhgef28 UTSW 13 97944686 missense probably benign 0.03
R7500:Arhgef28 UTSW 13 97978495 missense probably benign 0.00
R7653:Arhgef28 UTSW 13 97969313 missense probably benign 0.04
R7813:Arhgef28 UTSW 13 97945681 missense possibly damaging 0.48
Z1088:Arhgef28 UTSW 13 97945691 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATACACAGGAGGGTTGTCAAGC -3'
(R):5'- CCCCTGTAGGTTCATTCAGTATG -3'

Sequencing Primer
(F):5'- CACAGGAGGGTTGTCAAGCTTTTC -3'
(R):5'- AGTATGTATTATCTCGTGATGACTCC -3'
Posted On2018-07-24