Incidental Mutation 'R6646:Rpl15'
ID527984
Institutional Source Beutler Lab
Gene Symbol Rpl15
Ensembl Gene ENSMUSG00000012405
Gene Nameribosomal protein L15
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.928) question?
Stock #R6646 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location18267823-18271391 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 18270040 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 59 (Y59C)
Ref Sequence ENSEMBL: ENSMUSP00000119852 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022294] [ENSMUST00000079419] [ENSMUST00000080281] [ENSMUST00000100799] [ENSMUST00000112598] [ENSMUST00000132374] [ENSMUST00000133460] [ENSMUST00000147121]
Predicted Effect probably benign
Transcript: ENSMUST00000022294
SMART Domains Protein: ENSMUSP00000022294
Gene: ENSMUSG00000021772

DomainStartEndE-ValueType
SCOP:d1i2ma_ 5 39 1e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000079419
AA Change: Y59C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000078388
Gene: ENSMUSG00000012405
AA Change: Y59C

DomainStartEndE-ValueType
Pfam:Ribosomal_L15e 2 193 2.3e-101 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000080281
AA Change: Y59C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000079163
Gene: ENSMUSG00000012405
AA Change: Y59C

DomainStartEndE-ValueType
Pfam:Ribosomal_L15e 2 193 2.3e-101 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000100799
AA Change: Y59C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000098362
Gene: ENSMUSG00000012405
AA Change: Y59C

DomainStartEndE-ValueType
Pfam:Ribosomal_L15e 2 193 2.3e-101 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112598
AA Change: Y59C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000108217
Gene: ENSMUSG00000012405
AA Change: Y59C

DomainStartEndE-ValueType
Pfam:Ribosomal_L15e 2 193 2.3e-101 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132374
SMART Domains Protein: ENSMUSP00000121496
Gene: ENSMUSG00000021772

DomainStartEndE-ValueType
Pfam:Arf 1 168 7.8e-11 PFAM
Pfam:Roc 6 124 1.6e-13 PFAM
Pfam:Ras 6 170 5.2e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133460
SMART Domains Protein: ENSMUSP00000122235
Gene: ENSMUSG00000021772

DomainStartEndE-ValueType
Pfam:Arf 4 115 1.7e-7 PFAM
Pfam:Ras 4 118 1.3e-21 PFAM
Pfam:Miro 5 97 1.7e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145355
Predicted Effect probably damaging
Transcript: ENSMUST00000147121
AA Change: Y59C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000119852
Gene: ENSMUSG00000012405
AA Change: Y59C

DomainStartEndE-ValueType
Pfam:Ribosomal_L15e 2 107 2.7e-54 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150209
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152735
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156186
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224196
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.4%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L15E family of ribosomal proteins. It is located in the cytoplasm. This gene shares sequence similarity with the yeast ribosomal protein YL10 gene. Although this gene has been referred to as RPL10, its official symbol is RPL15. This gene has been shown to be overexpressed in some esophageal tumors compared to normal matched tissues. Alternate splicing results in multiple transcript variants. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Nov 2011]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T A 10: 82,296,830 E115D unknown Het
Ada G T 2: 163,735,423 N48K probably benign Het
Aldh1a7 C T 19: 20,699,911 A449T possibly damaging Het
Arhgef28 A G 13: 97,939,494 V1344A probably benign Het
Carmil3 A T 14: 55,507,930 E1371D probably damaging Het
Crebbp C T 16: 4,119,806 A698T possibly damaging Het
Dedd2 T C 7: 25,203,613 D307G probably damaging Het
Dennd6b G T 15: 89,186,184 F427L probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Doc2a G A 7: 126,851,619 probably null Het
Dst A G 1: 34,268,807 T6503A possibly damaging Het
Ehmt1 A T 2: 24,806,310 I922K probably damaging Het
Gbp9 A G 5: 105,082,903 I385T probably benign Het
Gipc2 A T 3: 152,094,201 D297E possibly damaging Het
Krt6b T A 15: 101,677,214 Q428L probably damaging Het
Loxl4 T C 19: 42,598,781 D625G probably damaging Het
Lrrn2 C T 1: 132,939,056 P620S probably benign Het
Msh6 T C 17: 87,986,442 V875A possibly damaging Het
Nebl T C 2: 17,376,685 T727A probably damaging Het
Obscn T C 11: 59,082,718 D1929G possibly damaging Het
Pard3b T C 1: 62,161,121 V273A probably benign Het
Pcdhb7 T A 18: 37,343,974 V721E possibly damaging Het
Plaa A T 4: 94,589,978 H82Q probably benign Het
Plcd1 T A 9: 119,075,032 Y278F probably damaging Het
Plxnb1 C A 9: 109,108,827 H1214N probably benign Het
Ptprg C A 14: 11,962,714 P171T probably damaging Het
Rela T G 19: 5,647,104 D446E probably damaging Het
Rpap1 T C 2: 119,780,131 I156V probably benign Het
Scx C A 15: 76,457,921 T107N probably damaging Het
Skint5 T A 4: 113,940,777 K203I possibly damaging Het
Slc16a6 C T 11: 109,453,162 M518I probably benign Het
Sorbs1 C T 19: 40,325,549 G940R probably damaging Het
Synm A T 7: 67,735,127 I487K probably damaging Het
Tcerg1l A T 7: 138,395,183 probably null Het
Vmn2r99 T G 17: 19,380,031 L439R probably damaging Het
Wdr75 T A 1: 45,799,087 L52Q probably damaging Het
Zswim2 T A 2: 83,915,784 R437* probably null Het
Other mutations in Rpl15
AlleleSourceChrCoordTypePredicted EffectPPH Score
R7869:Rpl15 UTSW 14 18269017 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATCCCCACCTTATACCGAGG -3'
(R):5'- GGGTGGTCTATAACACTCCCAG -3'

Sequencing Primer
(F):5'- AGGGAAACTCCACCGGCTTC -3'
(R):5'- TCAGTTTGGAAGTGCCCC -3'
Posted On2018-07-24