Incidental Mutation 'R6646:Scx'
ID527986
Institutional Source Beutler Lab
Gene Symbol Scx
Ensembl Gene ENSMUSG00000034161
Gene Namescleraxis
SynonymsbHLHa41, Scl
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6646 (G1)
Quality Score102.008
Status Validated
Chromosome15
Chromosomal Location76457452-76459458 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 76457921 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Asparagine at position 107 (T107N)
Ref Sequence ENSEMBL: ENSMUSP00000043668 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023217] [ENSMUST00000043089] [ENSMUST00000096385]
Predicted Effect probably benign
Transcript: ENSMUST00000023217
SMART Domains Protein: ENSMUSP00000023217
Gene: ENSMUSG00000022557

DomainStartEndE-ValueType
low complexity region 31 48 N/A INTRINSIC
low complexity region 106 117 N/A INTRINSIC
BOP1NT 130 388 1.38e-177 SMART
WD40 388 427 1.16e-9 SMART
WD40 430 469 6.16e0 SMART
WD40 508 551 7.1e1 SMART
WD40 554 592 4.46e-1 SMART
WD40 595 634 2.76e-2 SMART
WD40 638 677 4.14e-6 SMART
WD40 689 732 3.14e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000043089
AA Change: T107N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000043668
Gene: ENSMUSG00000034161
AA Change: T107N

DomainStartEndE-ValueType
low complexity region 24 38 N/A INTRINSIC
low complexity region 45 80 N/A INTRINSIC
HLH 84 136 1.46e-16 SMART
low complexity region 161 171 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000096385
SMART Domains Protein: ENSMUSP00000094115
Gene: ENSMUSG00000022558

DomainStartEndE-ValueType
low complexity region 442 455 N/A INTRINSIC
low complexity region 594 607 N/A INTRINSIC
low complexity region 799 810 N/A INTRINSIC
low complexity region 935 946 N/A INTRINSIC
low complexity region 1191 1202 N/A INTRINSIC
low complexity region 1355 1367 N/A INTRINSIC
low complexity region 1488 1502 N/A INTRINSIC
Pfam:HEAT 1610 1640 2.2e-5 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160986
Predicted Effect probably benign
Transcript: ENSMUST00000161265
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161350
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161683
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229132
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229271
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229633
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229897
Meta Mutation Damage Score 0.3615 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.4%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: This gene encodes a basic helix-loop-helix type transcription factor involved in mesoderm and heart valve formation. The encoded protein is expressed during embryonic development of tendons and ligaments. The gene product regulates collagen type I gene expression in cardiac fibroblasts and myofibroblasts, and it may play a role in myocardial remodeling. The protein is expressed in the scar area of the adult heart following myocardial infarction. [provided by RefSeq, Feb 2010]
PHENOTYPE: Homozygotes for a targeted mutation develop normally up to E6.0-E6.5, but become arrested and fail to gastrulate and form mesodermal cells. In chimeric embryos, mutant cells are excluded from sclerotome-derived chondrogenic lineages but contribute to other cell types, including mesodermal tissues. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T A 10: 82,296,830 E115D unknown Het
Ada G T 2: 163,735,423 N48K probably benign Het
Aldh1a7 C T 19: 20,699,911 A449T possibly damaging Het
Arhgef28 A G 13: 97,939,494 V1344A probably benign Het
Carmil3 A T 14: 55,507,930 E1371D probably damaging Het
Crebbp C T 16: 4,119,806 A698T possibly damaging Het
Dedd2 T C 7: 25,203,613 D307G probably damaging Het
Dennd6b G T 15: 89,186,184 F427L probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Doc2a G A 7: 126,851,619 probably null Het
Dst A G 1: 34,268,807 T6503A possibly damaging Het
Ehmt1 A T 2: 24,806,310 I922K probably damaging Het
Gbp9 A G 5: 105,082,903 I385T probably benign Het
Gipc2 A T 3: 152,094,201 D297E possibly damaging Het
Krt6b T A 15: 101,677,214 Q428L probably damaging Het
Loxl4 T C 19: 42,598,781 D625G probably damaging Het
Lrrn2 C T 1: 132,939,056 P620S probably benign Het
Msh6 T C 17: 87,986,442 V875A possibly damaging Het
Nebl T C 2: 17,376,685 T727A probably damaging Het
Obscn T C 11: 59,082,718 D1929G possibly damaging Het
Pard3b T C 1: 62,161,121 V273A probably benign Het
Pcdhb7 T A 18: 37,343,974 V721E possibly damaging Het
Plaa A T 4: 94,589,978 H82Q probably benign Het
Plcd1 T A 9: 119,075,032 Y278F probably damaging Het
Plxnb1 C A 9: 109,108,827 H1214N probably benign Het
Ptprg C A 14: 11,962,714 P171T probably damaging Het
Rela T G 19: 5,647,104 D446E probably damaging Het
Rpap1 T C 2: 119,780,131 I156V probably benign Het
Rpl15 T C 14: 18,270,040 Y59C probably damaging Het
Skint5 T A 4: 113,940,777 K203I possibly damaging Het
Slc16a6 C T 11: 109,453,162 M518I probably benign Het
Sorbs1 C T 19: 40,325,549 G940R probably damaging Het
Synm A T 7: 67,735,127 I487K probably damaging Het
Tcerg1l A T 7: 138,395,183 probably null Het
Vmn2r99 T G 17: 19,380,031 L439R probably damaging Het
Wdr75 T A 1: 45,799,087 L52Q probably damaging Het
Zswim2 T A 2: 83,915,784 R437* probably null Het
Other mutations in Scx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02221:Scx APN 15 76459095 missense probably benign 0.04
R0615:Scx UTSW 15 76458095 missense probably benign 0.23
R2698:Scx UTSW 15 76458163 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCAGTCCGAACACATGTG -3'
(R):5'- CAGAAGGTGCAGATCTGTTTGG -3'

Sequencing Primer
(F):5'- AGAAACCCTGCCGTGTG -3'
(R):5'- CGTCTCTGGCCAGTGGTG -3'
Posted On2018-07-24