Incidental Mutation 'R6646:Dennd6b'
ID527987
Institutional Source Beutler Lab
Gene Symbol Dennd6b
Ensembl Gene ENSMUSG00000015377
Gene NameDENN/MADD domain containing 6B
SynonymsFam116b, 1700027J05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.126) question?
Stock #R6646 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location89182213-89196496 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 89186184 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 427 (F427L)
Ref Sequence ENSEMBL: ENSMUSP00000077978 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078953] [ENSMUST00000229755]
Predicted Effect probably damaging
Transcript: ENSMUST00000078953
AA Change: F427L

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000077978
Gene: ENSMUSG00000015377
AA Change: F427L

DomainStartEndE-ValueType
low complexity region 4 31 N/A INTRINSIC
Pfam:Avl9 42 181 1.1e-8 PFAM
Pfam:DENN 148 344 1.2e-8 PFAM
Pfam:SPA 248 358 6.7e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184207
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229416
Predicted Effect probably benign
Transcript: ENSMUST00000229755
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229935
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230111
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230823
Meta Mutation Damage Score 0.8822 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.4%
Validation Efficiency 100% (41/41)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T A 10: 82,296,830 E115D unknown Het
Ada G T 2: 163,735,423 N48K probably benign Het
Aldh1a7 C T 19: 20,699,911 A449T possibly damaging Het
Arhgef28 A G 13: 97,939,494 V1344A probably benign Het
Carmil3 A T 14: 55,507,930 E1371D probably damaging Het
Crebbp C T 16: 4,119,806 A698T possibly damaging Het
Dedd2 T C 7: 25,203,613 D307G probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Doc2a G A 7: 126,851,619 probably null Het
Dst A G 1: 34,268,807 T6503A possibly damaging Het
Ehmt1 A T 2: 24,806,310 I922K probably damaging Het
Gbp9 A G 5: 105,082,903 I385T probably benign Het
Gipc2 A T 3: 152,094,201 D297E possibly damaging Het
Krt6b T A 15: 101,677,214 Q428L probably damaging Het
Loxl4 T C 19: 42,598,781 D625G probably damaging Het
Lrrn2 C T 1: 132,939,056 P620S probably benign Het
Msh6 T C 17: 87,986,442 V875A possibly damaging Het
Nebl T C 2: 17,376,685 T727A probably damaging Het
Obscn T C 11: 59,082,718 D1929G possibly damaging Het
Pard3b T C 1: 62,161,121 V273A probably benign Het
Pcdhb7 T A 18: 37,343,974 V721E possibly damaging Het
Plaa A T 4: 94,589,978 H82Q probably benign Het
Plcd1 T A 9: 119,075,032 Y278F probably damaging Het
Plxnb1 C A 9: 109,108,827 H1214N probably benign Het
Ptprg C A 14: 11,962,714 P171T probably damaging Het
Rela T G 19: 5,647,104 D446E probably damaging Het
Rpap1 T C 2: 119,780,131 I156V probably benign Het
Rpl15 T C 14: 18,270,040 Y59C probably damaging Het
Scx C A 15: 76,457,921 T107N probably damaging Het
Skint5 T A 4: 113,940,777 K203I possibly damaging Het
Slc16a6 C T 11: 109,453,162 M518I probably benign Het
Sorbs1 C T 19: 40,325,549 G940R probably damaging Het
Synm A T 7: 67,735,127 I487K probably damaging Het
Tcerg1l A T 7: 138,395,183 probably null Het
Vmn2r99 T G 17: 19,380,031 L439R probably damaging Het
Wdr75 T A 1: 45,799,087 L52Q probably damaging Het
Zswim2 T A 2: 83,915,784 R437* probably null Het
Other mutations in Dennd6b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02709:Dennd6b APN 15 89190922 splice site probably benign
IGL03109:Dennd6b APN 15 89184985 utr 3 prime probably benign
IGL03133:Dennd6b APN 15 89188523 critical splice acceptor site probably null
P0016:Dennd6b UTSW 15 89186977 missense probably benign
PIT4791001:Dennd6b UTSW 15 89186752 critical splice donor site probably null
R0025:Dennd6b UTSW 15 89186183 missense probably benign 0.11
R0025:Dennd6b UTSW 15 89186183 missense probably benign 0.11
R0268:Dennd6b UTSW 15 89196229 missense probably benign 0.01
R0344:Dennd6b UTSW 15 89196229 missense probably benign 0.01
R0391:Dennd6b UTSW 15 89187214 missense probably damaging 1.00
R1453:Dennd6b UTSW 15 89188872 missense probably damaging 0.99
R1655:Dennd6b UTSW 15 89196340 missense unknown
R1670:Dennd6b UTSW 15 89185337 intron probably benign
R1765:Dennd6b UTSW 15 89190303 nonsense probably null
R1968:Dennd6b UTSW 15 89190341 missense possibly damaging 0.63
R3692:Dennd6b UTSW 15 89186827 splice site probably benign
R4344:Dennd6b UTSW 15 89188663 missense probably benign 0.00
R4736:Dennd6b UTSW 15 89185592 missense probably benign 0.00
R5030:Dennd6b UTSW 15 89196251 missense possibly damaging 0.82
R5058:Dennd6b UTSW 15 89187350 missense possibly damaging 0.69
R5509:Dennd6b UTSW 15 89185022 missense probably damaging 1.00
R6005:Dennd6b UTSW 15 89188168 missense possibly damaging 0.91
R6160:Dennd6b UTSW 15 89188821 missense probably damaging 0.97
R6535:Dennd6b UTSW 15 89186367 missense probably damaging 1.00
R7098:Dennd6b UTSW 15 89188687 missense probably damaging 1.00
R7169:Dennd6b UTSW 15 89188852 missense possibly damaging 0.80
R7381:Dennd6b UTSW 15 89186173 missense possibly damaging 0.84
R7706:Dennd6b UTSW 15 89185244 missense probably benign 0.19
R8070:Dennd6b UTSW 15 89185373 missense probably benign 0.29
X0063:Dennd6b UTSW 15 89185420 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGGGACTAAATTGACACCCC -3'
(R):5'- ACGACTGCTCAAGGTACAGC -3'

Sequencing Primer
(F):5'- TGGACTCCACCTTCCAGG -3'
(R):5'- CAGTCGATGTTGAGTCAG -3'
Posted On2018-07-24