Incidental Mutation 'R6646:Rela'
ID527993
Institutional Source Beutler Lab
Gene Symbol Rela
Ensembl Gene ENSMUSG00000024927
Gene Namev-rel reticuloendotheliosis viral oncogene homolog A (avian)
Synonymsp65, p65 NF kappaB
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6646 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location5637483-5648130 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 5647104 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 446 (D446E)
Ref Sequence ENSEMBL: ENSMUSP00000025867 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025867] [ENSMUST00000071857] [ENSMUST00000080824] [ENSMUST00000164304] [ENSMUST00000169854]
PDB Structure
STRUCTURE OF NF-KB P50 HOMODIMER BOUND TO A KB SITE [X-RAY DIFFRACTION]
IKAPPABALPHA/NF-KAPPAB COMPLEX [X-RAY DIFFRACTION]
X-ray crystal structure of the IkBb/NF-kB p65 homodimer complex [X-RAY DIFFRACTION]
Crystal structure of a NF-kB heterodimer bound to an IFNb-kB [X-RAY DIFFRACTION]
Crystal structure of a NF-kB heterodimer bound to the Ig/HIV-kB siti [X-RAY DIFFRACTION]
The kB DNA sequence from the HLV-LTR functions as an allosteric regulator of HIV transcription [X-RAY DIFFRACTION]
NF-kappaB p65 subunit dimerization domain homodimer [X-RAY DIFFRACTION]
NF-kappaB p65 subunit dimerization domain homodimer N202R mutation [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF AN IKBBETA/NF-KB P65 HOMODIMER COMPLEX [X-RAY DIFFRACTION]
A NOVEL DNA RECOGNITION MODE BY NF-KB P65 HOMODIMER [X-RAY DIFFRACTION]
>> 4 additional structures at PDB <<
Predicted Effect probably damaging
Transcript: ENSMUST00000025867
AA Change: D446E

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000025867
Gene: ENSMUSG00000024927
AA Change: D446E

DomainStartEndE-ValueType
Pfam:RHD_DNA_bind 21 186 3.6e-72 PFAM
IPT 193 289 2.81e-22 SMART
low complexity region 377 389 N/A INTRINSIC
low complexity region 399 417 N/A INTRINSIC
PDB:2LWW|B 425 490 1e-37 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000071857
SMART Domains Protein: ENSMUSP00000073618
Gene: ENSMUSG00000056917

DomainStartEndE-ValueType
low complexity region 59 70 N/A INTRINSIC
low complexity region 90 103 N/A INTRINSIC
low complexity region 164 192 N/A INTRINSIC
low complexity region 278 292 N/A INTRINSIC
Pfam:Rap_GAP 346 529 7.2e-64 PFAM
low complexity region 580 593 N/A INTRINSIC
PDZ 692 758 9.51e-7 SMART
low complexity region 828 841 N/A INTRINSIC
low complexity region 872 883 N/A INTRINSIC
coiled coil region 969 1023 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000080824
SMART Domains Protein: ENSMUSP00000079637
Gene: ENSMUSG00000056917

DomainStartEndE-ValueType
low complexity region 59 70 N/A INTRINSIC
low complexity region 90 103 N/A INTRINSIC
low complexity region 164 192 N/A INTRINSIC
low complexity region 278 292 N/A INTRINSIC
Pfam:Rap_GAP 346 535 4.4e-60 PFAM
low complexity region 580 593 N/A INTRINSIC
PDZ 692 758 9.51e-7 SMART
low complexity region 828 841 N/A INTRINSIC
low complexity region 872 883 N/A INTRINSIC
coiled coil region 969 1023 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164304
SMART Domains Protein: ENSMUSP00000128208
Gene: ENSMUSG00000056917

DomainStartEndE-ValueType
low complexity region 59 70 N/A INTRINSIC
low complexity region 90 103 N/A INTRINSIC
low complexity region 164 192 N/A INTRINSIC
low complexity region 278 292 N/A INTRINSIC
Pfam:Rap_GAP 346 535 4.4e-60 PFAM
low complexity region 580 593 N/A INTRINSIC
PDZ 692 758 9.51e-7 SMART
low complexity region 828 841 N/A INTRINSIC
low complexity region 872 883 N/A INTRINSIC
coiled coil region 969 1023 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169854
SMART Domains Protein: ENSMUSP00000132345
Gene: ENSMUSG00000056917

DomainStartEndE-ValueType
low complexity region 59 70 N/A INTRINSIC
low complexity region 90 103 N/A INTRINSIC
low complexity region 164 192 N/A INTRINSIC
low complexity region 278 292 N/A INTRINSIC
Pfam:Rap_GAP 346 535 4.4e-60 PFAM
low complexity region 580 593 N/A INTRINSIC
PDZ 692 758 9.51e-7 SMART
low complexity region 828 841 N/A INTRINSIC
low complexity region 872 883 N/A INTRINSIC
coiled coil region 969 1023 N/A INTRINSIC
Meta Mutation Damage Score 0.1452 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.4%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NF-kappa-B is a ubiquitous transcription factor involved in several biological processes. It is held in the cytoplasm in an inactive state by specific inhibitors. Upon degradation of the inhibitor, NF-kappa-B moves to the nucleus and activates transcription of specific genes. NF-kappa-B is composed of NFKB1 or NFKB2 bound to either REL, RELA, or RELB. The most abundant form of NF-kappa-B is NFKB1 complexed with the product of this gene, RELA. Four transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygous null mice are embryonic lethal due to hepatic apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T A 10: 82,296,830 E115D unknown Het
Ada G T 2: 163,735,423 N48K probably benign Het
Aldh1a7 C T 19: 20,699,911 A449T possibly damaging Het
Arhgef28 A G 13: 97,939,494 V1344A probably benign Het
Carmil3 A T 14: 55,507,930 E1371D probably damaging Het
Crebbp C T 16: 4,119,806 A698T possibly damaging Het
Dedd2 T C 7: 25,203,613 D307G probably damaging Het
Dennd6b G T 15: 89,186,184 F427L probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Doc2a G A 7: 126,851,619 probably null Het
Dst A G 1: 34,268,807 T6503A possibly damaging Het
Ehmt1 A T 2: 24,806,310 I922K probably damaging Het
Gbp9 A G 5: 105,082,903 I385T probably benign Het
Gipc2 A T 3: 152,094,201 D297E possibly damaging Het
Krt6b T A 15: 101,677,214 Q428L probably damaging Het
Loxl4 T C 19: 42,598,781 D625G probably damaging Het
Lrrn2 C T 1: 132,939,056 P620S probably benign Het
Msh6 T C 17: 87,986,442 V875A possibly damaging Het
Nebl T C 2: 17,376,685 T727A probably damaging Het
Obscn T C 11: 59,082,718 D1929G possibly damaging Het
Pard3b T C 1: 62,161,121 V273A probably benign Het
Pcdhb7 T A 18: 37,343,974 V721E possibly damaging Het
Plaa A T 4: 94,589,978 H82Q probably benign Het
Plcd1 T A 9: 119,075,032 Y278F probably damaging Het
Plxnb1 C A 9: 109,108,827 H1214N probably benign Het
Ptprg C A 14: 11,962,714 P171T probably damaging Het
Rpap1 T C 2: 119,780,131 I156V probably benign Het
Rpl15 T C 14: 18,270,040 Y59C probably damaging Het
Scx C A 15: 76,457,921 T107N probably damaging Het
Skint5 T A 4: 113,940,777 K203I possibly damaging Het
Slc16a6 C T 11: 109,453,162 M518I probably benign Het
Sorbs1 C T 19: 40,325,549 G940R probably damaging Het
Synm A T 7: 67,735,127 I487K probably damaging Het
Tcerg1l A T 7: 138,395,183 probably null Het
Vmn2r99 T G 17: 19,380,031 L439R probably damaging Het
Wdr75 T A 1: 45,799,087 L52Q probably damaging Het
Zswim2 T A 2: 83,915,784 R437* probably null Het
Other mutations in Rela
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01905:Rela APN 19 5645564 missense probably benign 0.00
IGL02060:Rela APN 19 5638600 missense probably damaging 1.00
IGL02550:Rela APN 19 5641506 missense possibly damaging 0.58
IGL03130:Rela APN 19 5639881 missense probably damaging 1.00
H8786:Rela UTSW 19 5647018 missense probably benign 0.00
R1597:Rela UTSW 19 5645331 missense probably damaging 0.99
R4455:Rela UTSW 19 5647262 missense probably damaging 1.00
R5322:Rela UTSW 19 5645380 missense possibly damaging 0.48
R5994:Rela UTSW 19 5647064 missense possibly damaging 0.59
R6006:Rela UTSW 19 5639939 missense probably damaging 1.00
R6301:Rela UTSW 19 5645410 splice site probably null
R6318:Rela UTSW 19 5646964 missense probably benign 0.01
R6556:Rela UTSW 19 5647338 missense probably damaging 1.00
R7697:Rela UTSW 19 5641602 missense probably damaging 1.00
Z1176:Rela UTSW 19 5641649 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CTGTTACCATCAGGGCAGATCTC -3'
(R):5'- AGGCGAGTTATAGCTTCAGGG -3'

Sequencing Primer
(F):5'- TCAGGGCAGATCTCAAACCAGG -3'
(R):5'- ATAGCTTCAGGGTACTCCATCAG -3'
Posted On2018-07-24