Incidental Mutation 'R6646:Loxl4'
ID527996
Institutional Source Beutler Lab
Gene Symbol Loxl4
Ensembl Gene ENSMUSG00000025185
Gene Namelysyl oxidase-like 4
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6646 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location42593982-42612813 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 42598781 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 625 (D625G)
Ref Sequence ENSEMBL: ENSMUSP00000126686 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026190] [ENSMUST00000164786] [ENSMUST00000171432]
Predicted Effect probably damaging
Transcript: ENSMUST00000026190
AA Change: D625G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026190
Gene: ENSMUSG00000025185
AA Change: D625G

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
SR 33 134 1.57e-49 SMART
SR 160 288 3.96e-14 SMART
SR 312 412 2.6e-41 SMART
SR 422 530 5.41e-30 SMART
Pfam:Lysyl_oxidase 534 737 1.3e-113 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164014
Predicted Effect probably damaging
Transcript: ENSMUST00000164786
AA Change: D626G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125803
Gene: ENSMUSG00000025185
AA Change: D626G

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
SR 33 134 1.57e-49 SMART
SR 160 288 3.96e-14 SMART
SR 313 413 2.6e-41 SMART
SR 423 531 5.41e-30 SMART
Pfam:Lysyl_oxidase 535 735 1.8e-101 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000171432
AA Change: D625G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126686
Gene: ENSMUSG00000025185
AA Change: D625G

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
SR 33 134 1.57e-49 SMART
SR 160 288 3.96e-14 SMART
SR 312 412 2.6e-41 SMART
SR 422 530 5.41e-30 SMART
Pfam:Lysyl_oxidase 534 737 1.3e-113 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.4%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the lysyl oxidase gene family. The prototypic member of the family is essential to the biogenesis of connective tissue, encoding an extracellular copper-dependent amine oxidase that catalyses the first step in the formation of crosslinks in collagens and elastin. A highly conserved amino acid sequence at the C-terminus end appears to be sufficient for amine oxidase activity, suggesting that each family member may retain this function. The N-terminus is poorly conserved and may impart additional roles in developmental regulation, senescence, tumor suppression, cell growth control, and chemotaxis to each member of the family. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T A 10: 82,296,830 E115D unknown Het
Ada G T 2: 163,735,423 N48K probably benign Het
Aldh1a7 C T 19: 20,699,911 A449T possibly damaging Het
Arhgef28 A G 13: 97,939,494 V1344A probably benign Het
Carmil3 A T 14: 55,507,930 E1371D probably damaging Het
Crebbp C T 16: 4,119,806 A698T possibly damaging Het
Dedd2 T C 7: 25,203,613 D307G probably damaging Het
Dennd6b G T 15: 89,186,184 F427L probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Doc2a G A 7: 126,851,619 probably null Het
Dst A G 1: 34,268,807 T6503A possibly damaging Het
Ehmt1 A T 2: 24,806,310 I922K probably damaging Het
Gbp9 A G 5: 105,082,903 I385T probably benign Het
Gipc2 A T 3: 152,094,201 D297E possibly damaging Het
Krt6b T A 15: 101,677,214 Q428L probably damaging Het
Lrrn2 C T 1: 132,939,056 P620S probably benign Het
Msh6 T C 17: 87,986,442 V875A possibly damaging Het
Nebl T C 2: 17,376,685 T727A probably damaging Het
Obscn T C 11: 59,082,718 D1929G possibly damaging Het
Pard3b T C 1: 62,161,121 V273A probably benign Het
Pcdhb7 T A 18: 37,343,974 V721E possibly damaging Het
Plaa A T 4: 94,589,978 H82Q probably benign Het
Plcd1 T A 9: 119,075,032 Y278F probably damaging Het
Plxnb1 C A 9: 109,108,827 H1214N probably benign Het
Ptprg C A 14: 11,962,714 P171T probably damaging Het
Rela T G 19: 5,647,104 D446E probably damaging Het
Rpap1 T C 2: 119,780,131 I156V probably benign Het
Rpl15 T C 14: 18,270,040 Y59C probably damaging Het
Scx C A 15: 76,457,921 T107N probably damaging Het
Skint5 T A 4: 113,940,777 K203I possibly damaging Het
Slc16a6 C T 11: 109,453,162 M518I probably benign Het
Sorbs1 C T 19: 40,325,549 G940R probably damaging Het
Synm A T 7: 67,735,127 I487K probably damaging Het
Tcerg1l A T 7: 138,395,183 probably null Het
Vmn2r99 T G 17: 19,380,031 L439R probably damaging Het
Wdr75 T A 1: 45,799,087 L52Q probably damaging Het
Zswim2 T A 2: 83,915,784 R437* probably null Het
Other mutations in Loxl4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01472:Loxl4 APN 19 42597549 missense probably damaging 1.00
IGL02063:Loxl4 APN 19 42608339 missense probably benign 0.03
IGL02490:Loxl4 APN 19 42604830 missense probably benign
IGL02498:Loxl4 APN 19 42604973 missense probably benign 0.27
IGL03107:Loxl4 APN 19 42605279 missense probably benign 0.12
IGL03296:Loxl4 APN 19 42598823 splice site probably benign
R1145:Loxl4 UTSW 19 42608555 unclassified probably benign
R1697:Loxl4 UTSW 19 42604940 missense possibly damaging 0.86
R2126:Loxl4 UTSW 19 42603963 missense probably damaging 1.00
R2128:Loxl4 UTSW 19 42603963 missense probably damaging 1.00
R2148:Loxl4 UTSW 19 42604192 splice site probably null
R2159:Loxl4 UTSW 19 42600007 missense probably damaging 1.00
R3624:Loxl4 UTSW 19 42607576 missense probably benign 0.28
R4030:Loxl4 UTSW 19 42608359 missense probably damaging 1.00
R4181:Loxl4 UTSW 19 42607591 missense probably benign 0.00
R4302:Loxl4 UTSW 19 42607591 missense probably benign 0.00
R4700:Loxl4 UTSW 19 42607613 missense probably benign 0.07
R4701:Loxl4 UTSW 19 42607613 missense probably benign 0.07
R4719:Loxl4 UTSW 19 42607591 missense probably benign 0.00
R4724:Loxl4 UTSW 19 42608346 missense probably benign 0.23
R4750:Loxl4 UTSW 19 42605004 missense probably damaging 1.00
R4953:Loxl4 UTSW 19 42610694 unclassified probably benign
R5579:Loxl4 UTSW 19 42604290 missense probably damaging 1.00
R5840:Loxl4 UTSW 19 42598715 missense probably damaging 1.00
R5856:Loxl4 UTSW 19 42595366 missense possibly damaging 0.89
R5879:Loxl4 UTSW 19 42607627 missense probably benign 0.09
R6137:Loxl4 UTSW 19 42598793 missense probably damaging 1.00
R6180:Loxl4 UTSW 19 42608352 missense probably damaging 1.00
R6324:Loxl4 UTSW 19 42595378 missense probably benign 0.00
R6347:Loxl4 UTSW 19 42608270 missense probably damaging 1.00
R6788:Loxl4 UTSW 19 42608353 missense probably damaging 1.00
R7045:Loxl4 UTSW 19 42606635 missense probably damaging 1.00
R8013:Loxl4 UTSW 19 42607676 missense probably damaging 1.00
R8072:Loxl4 UTSW 19 42607582 missense probably damaging 1.00
R8546:Loxl4 UTSW 19 42607588 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGCTAGAATATTCAAGAGCCTAGGG -3'
(R):5'- TCTGTGACCATGCTCATCTTGG -3'

Sequencing Primer
(F):5'- GCCTAGGGCTATTGGACAGG -3'
(R):5'- ACCATGCTCATCTTGGACTTAGGAG -3'
Posted On2018-07-24