Mutagenetix > Incidental Mutations

Incidental Mutation 'R6662:Mgat5'

527999

Institutional Source

Beutler Lab

Gene Symbol

Mgat5

Ensembl Gene

ENSMUSG00000036155

Gene Name

mannoside acetylglucosaminyltransferase 5

Synonyms

4930471A21Rik, beta1,6N-acetylglucosaminyltransferase V, GlcNAc-TV, 5330407H02Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6662 (G1)

Quality Score

213.009

Status

Validated

Chromosome

Chromosomal Location

127205015-127488336 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 127469237 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Asparagine at position 574 (H574N)

Ref Sequence

ENSEMBL: ENSMUSP00000129166 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038361] [ENSMUST00000171405]

AlphaFold

Q8R4G6

Predicted Effect

probably damaging
Transcript: ENSMUST00000038361
AA Change: H574N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000038359
Gene: ENSMUSG00000036155
AA Change: H574N

Domain	Start	End	E-Value	Type
Pfam:DUF4525	2	138	3.4e-70	PFAM
Pfam:Glyco_transf_18	171	725	9.8e-268	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000171405
AA Change: H574N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000129166
Gene: ENSMUSG00000036155
AA Change: H574N

Domain	Start	End	E-Value	Type
Pfam:DUF4525	3	137	9.3e-64	PFAM
Pfam:Glyco_transf_18	171	725	1.9e-268	PFAM

Meta Mutation Damage Score

0.1425

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 94.8%

Validation Efficiency

100% (46/46)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the glycosyltransferase family. It catalyzes the addition of beta-1,6-N-acetylglucosamine to the alpha-linked mannose of biantennary N-linked oligosaccharides present on the newly synthesized glycoproteins. It is one of the most important enzymes involved in the regulation of the biosynthesis of glycoprotein oligosaccharides. Alterations of the oligosaccharides on cell surface glycoproteins cause significant changes in the adhesive or migratory behavior of a cell. Increase in the activity of this enzyme has been correlated with the progression of invasive malignancies. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for deficiencies in this gene have immune system abnormalities and reduced cancer growth and metastasis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ablim1	A	G	19: 57,073,853		probably null	Het
Acox1	A	G	11: 116,175,323	Y418H	probably damaging	Het
Akr1b3	C	T	6: 34,310,004	V206M	possibly damaging	Het
Aldh3a1	G	A	11: 61,214,655	V196I	probably benign	Het
Aox3	A	G	1: 58,118,615	K44E	probably damaging	Het
Bad	T	A	19: 6,951,070		probably benign	Het
BC034090	G	T	1: 155,226,339	Q60K	possibly damaging	Het
Casp6	A	G	3: 129,912,226	T181A	probably benign	Het
Catsperg2	G	A	7: 29,719,513		probably benign	Het
Ccdc14	T	C	16: 34,690,794	L46P	probably damaging	Het
Ces1b	A	G	8: 93,064,069	L364S	probably benign	Het
Cfap45	T	C	1: 172,529,850	I15T	probably benign	Het
D730048I06Rik	C	A	9: 35,790,000	R6M	possibly damaging	Het
Dph5	G	A	3: 115,928,556	E228K	probably benign	Het
Fat4	G	T	3: 38,956,821	L2023F	possibly damaging	Het
Garem1	T	C	18: 21,148,247	N351D	probably benign	Het
Gm14124	G	A	2: 150,266,252		probably null	Het
Grm2	C	T	9: 106,648,053	A488T	probably benign	Het
Ifit3b	A	G	19: 34,611,937	E171G	probably damaging	Het
Il1rn	A	T	2: 24,336,875		probably null	Het
Itih5	A	T	2: 10,249,181	I748F	probably benign	Het
Kcnh5	C	A	12: 75,007,611	D520Y	probably damaging	Het
Moxd1	A	C	10: 24,284,760	D437A	probably damaging	Het
Mybpc2	A	G	7: 44,506,166	F888L	probably benign	Het
Ncs1	T	A	2: 31,287,360	L183Q	probably damaging	Het
Neto2	A	T	8: 85,663,215	D206E	probably damaging	Het
Omp	A	G	7: 98,145,339	L27P	probably damaging	Het
Oxsm	A	G	14: 16,242,287	S161P	probably benign	Het
Pde4b	A	G	4: 102,601,898	I381M	possibly damaging	Het
Pramel5	A	T	4: 144,273,105	N137K	probably benign	Het
Prss33	T	C	17: 23,833,960	S247G	probably damaging	Het
Rassf9	T	A	10: 102,546,038	L425Q	possibly damaging	Het
Setx	A	T	2: 29,158,114	D1909V	probably damaging	Het
Slc26a3	A	T	12: 31,457,346	K402*	probably null	Het
Slco1a6	G	A	6: 142,133,215	T118I	probably damaging	Het
Syne1	A	G	10: 5,128,416	L6769P	probably damaging	Het
Tas2r107	A	T	6: 131,659,489	V199D	possibly damaging	Het
Tchp	A	G	5: 114,720,015		probably null	Het
Trdn	A	T	10: 33,474,487	N684I	probably damaging	Het
Trio	G	T	15: 27,854,996	T700K	probably benign	Het
Ttn	C	T	2: 76,755,898	V20084I	probably benign	Het
Ubl3	A	T	5: 148,509,306	Y62*	probably null	Het
Uckl1	A	G	2: 181,573,260	Y267H	possibly damaging	Het
Zfp786	T	C	6: 47,826,986	N41D	probably damaging	Het
Zfp983	T	C	17: 21,662,085	S310P	probably damaging	Het

Other mutations in Mgat5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00479:Mgat5	APN	1	127387467	missense	probably damaging	1.00
IGL00813:Mgat5	APN	1	127384806	missense	probably benign
IGL01795:Mgat5	APN	1	127469231	missense	probably damaging	0.98
IGL01830:Mgat5	APN	1	127412132	missense	probably damaging	1.00
IGL01879:Mgat5	APN	1	127397550	missense	probably damaging	0.99
IGL02322:Mgat5	APN	1	127382985	missense	probably benign	0.00
IGL02621:Mgat5	APN	1	127397589	missense	possibly damaging	0.86
IGL02695:Mgat5	APN	1	127412131	missense	probably damaging	1.00
IGL03142:Mgat5	APN	1	127412223	missense	probably damaging	1.00
Cowlick	UTSW	1	127471564	missense	probably benign	0.36
Curls	UTSW	1	127320634	missense	possibly damaging	0.77
R0518:Mgat5	UTSW	1	127384847	missense	probably damaging	1.00
R0594:Mgat5	UTSW	1	127412248	missense	probably damaging	0.96
R1480:Mgat5	UTSW	1	127459979	missense	probably damaging	1.00
R1501:Mgat5	UTSW	1	127397641	critical splice donor site	probably null
R1712:Mgat5	UTSW	1	127320638	missense	probably benign	0.34
R1744:Mgat5	UTSW	1	127479469	missense	probably damaging	1.00
R1862:Mgat5	UTSW	1	127459969	missense	probably damaging	1.00
R1994:Mgat5	UTSW	1	127459959	missense	possibly damaging	0.82
R2054:Mgat5	UTSW	1	127397607	missense	probably damaging	1.00
R2150:Mgat5	UTSW	1	127469250	missense	probably damaging	1.00
R2303:Mgat5	UTSW	1	127446299	missense	probably benign	0.00
R2566:Mgat5	UTSW	1	127307004	missense	probably benign	0.01
R3498:Mgat5	UTSW	1	127384834	missense	possibly damaging	0.55
R3788:Mgat5	UTSW	1	127366443	missense	probably benign
R4674:Mgat5	UTSW	1	127390758	missense	probably damaging	1.00
R4873:Mgat5	UTSW	1	127469249	missense	probably damaging	1.00
R4875:Mgat5	UTSW	1	127469249	missense	probably damaging	1.00
R5175:Mgat5	UTSW	1	127459912	missense	probably damaging	0.97
R5310:Mgat5	UTSW	1	127387514	critical splice donor site	probably null
R5337:Mgat5	UTSW	1	127459921	missense	possibly damaging	0.84
R5597:Mgat5	UTSW	1	127397566	missense	probably damaging	1.00
R5599:Mgat5	UTSW	1	127397566	missense	probably damaging	1.00
R5861:Mgat5	UTSW	1	127387392	missense	probably damaging	1.00
R5956:Mgat5	UTSW	1	127382939	missense	probably benign	0.10
R6042:Mgat5	UTSW	1	127459899	missense	probably damaging	1.00
R6223:Mgat5	UTSW	1	127382979	missense	possibly damaging	0.86
R6492:Mgat5	UTSW	1	127471564	missense	probably benign	0.36
R6960:Mgat5	UTSW	1	127320634	missense	possibly damaging	0.77
R6981:Mgat5	UTSW	1	127390851	missense	probably damaging	0.98
R7110:Mgat5	UTSW	1	127382979	missense	possibly damaging	0.92
R7133:Mgat5	UTSW	1	127365189	missense	probably benign
R7142:Mgat5	UTSW	1	127412187	missense	probably damaging	1.00
R7151:Mgat5	UTSW	1	127446262	missense	probably damaging	0.97
R7506:Mgat5	UTSW	1	127366455	missense	probably benign	0.24
R7790:Mgat5	UTSW	1	127412204	missense	probably benign	0.23
R7980:Mgat5	UTSW	1	127479511	missense	probably benign	0.13
R8548:Mgat5	UTSW	1	127320672	missense	possibly damaging	0.77
R9008:Mgat5	UTSW	1	127479571	missense	probably damaging	1.00
R9127:Mgat5	UTSW	1	127366460	missense	probably benign	0.14
R9279:Mgat5	UTSW	1	127397611	missense	probably damaging	1.00
X0028:Mgat5	UTSW	1	127366485	missense	possibly damaging	0.91
Z1177:Mgat5	UTSW	1	127482692	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGTTTGCTACAGGGAGGACAAG -3'
(R):5'- TTTACTGACAGCAAGGGACTG -3'

Sequencing Primer
(F):5'- GGAGGACAAGAACGCTTCATCTC -3'
(R):5'- GACTGCAATGTCCCACATGTG -3'

Posted On

2018-07-24