Incidental Mutation 'R6662:Itih5'
ID528002
Institutional Source Beutler Lab
Gene Symbol Itih5
Ensembl Gene ENSMUSG00000025780
Gene Nameinter-alpha (globulin) inhibitor H5
Synonyms5430408M01Rik, 4631408O11Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R6662 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location10153571-10256529 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 10249181 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 748 (I748F)
Ref Sequence ENSEMBL: ENSMUSP00000026886 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026886]
Predicted Effect probably benign
Transcript: ENSMUST00000026886
AA Change: I748F

PolyPhen 2 Score 0.129 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000026886
Gene: ENSMUSG00000025780
AA Change: I748F

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 30 45 N/A INTRINSIC
Pfam:VIT 51 159 5.5e-27 PFAM
VWA 293 476 5.84e-24 SMART
Pfam:ITI_HC_C 716 909 1.7e-60 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a heavy chain component of one of the inter-alpha-trypsin inhibitor (ITI) family members. ITI proteins are involved in extracellular matrix stabilization and in the prevention of tumor metastasis. They are also structurally related plasma serine protease inhibitors and are composed of a light chain and varying numbers of heavy chains. This family member is thought to function as a tumor suppressor in breast and thyroid cancers. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 A G 19: 57,073,853 probably null Het
Acox1 A G 11: 116,175,323 Y418H probably damaging Het
Akr1b3 C T 6: 34,310,004 V206M possibly damaging Het
Aldh3a1 G A 11: 61,214,655 V196I probably benign Het
Aox3 A G 1: 58,118,615 K44E probably damaging Het
Bad T A 19: 6,951,070 probably benign Het
BC034090 G T 1: 155,226,339 Q60K possibly damaging Het
Casp6 A G 3: 129,912,226 T181A probably benign Het
Catsperg2 G A 7: 29,719,513 probably benign Het
Ccdc14 T C 16: 34,690,794 L46P probably damaging Het
Ces1b A G 8: 93,064,069 L364S probably benign Het
Cfap45 T C 1: 172,529,850 I15T probably benign Het
D730048I06Rik C A 9: 35,790,000 R6M possibly damaging Het
Dph5 G A 3: 115,928,556 E228K probably benign Het
Fat4 G T 3: 38,956,821 L2023F possibly damaging Het
Garem1 T C 18: 21,148,247 N351D probably benign Het
Gm14124 G A 2: 150,266,252 probably null Het
Grm2 C T 9: 106,648,053 A488T probably benign Het
Ifit3b A G 19: 34,611,937 E171G probably damaging Het
Il1rn A T 2: 24,336,875 probably null Het
Kcnh5 C A 12: 75,007,611 D520Y probably damaging Het
Mgat5 C A 1: 127,469,237 H574N probably damaging Het
Moxd1 A C 10: 24,284,760 D437A probably damaging Het
Mybpc2 A G 7: 44,506,166 F888L probably benign Het
Ncs1 T A 2: 31,287,360 L183Q probably damaging Het
Neto2 A T 8: 85,663,215 D206E probably damaging Het
Omp A G 7: 98,145,339 L27P probably damaging Het
Oxsm A G 14: 16,242,287 S161P probably benign Het
Pde4b A G 4: 102,601,898 I381M possibly damaging Het
Pramel5 A T 4: 144,273,105 N137K probably benign Het
Prss33 T C 17: 23,833,960 S247G probably damaging Het
Rassf9 T A 10: 102,546,038 L425Q possibly damaging Het
Setx A T 2: 29,158,114 D1909V probably damaging Het
Slc26a3 A T 12: 31,457,346 K402* probably null Het
Slco1a6 G A 6: 142,133,215 T118I probably damaging Het
Syne1 A G 10: 5,128,416 L6769P probably damaging Het
Tas2r107 A T 6: 131,659,489 V199D possibly damaging Het
Tchp A G 5: 114,720,015 probably null Het
Trdn A T 10: 33,474,487 N684I probably damaging Het
Trio G T 15: 27,854,996 T700K probably benign Het
Ttn C T 2: 76,755,898 V20084I probably benign Het
Ubl3 A T 5: 148,509,306 Y62* probably null Het
Uckl1 A G 2: 181,573,260 Y267H possibly damaging Het
Zfp786 T C 6: 47,826,986 N41D probably damaging Het
Zfp983 T C 17: 21,662,085 S310P probably damaging Het
Other mutations in Itih5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01481:Itih5 APN 2 10190289 missense probably damaging 1.00
IGL02125:Itih5 APN 2 10240987 missense probably benign
IGL02370:Itih5 APN 2 10186975 missense probably benign 0.05
IGL03376:Itih5 APN 2 10206773 missense probably benign 0.12
IGL02991:Itih5 UTSW 2 10251351 missense probably benign 0.01
R0090:Itih5 UTSW 2 10164684 missense probably benign 0.03
R0096:Itih5 UTSW 2 10251378 missense probably benign 0.02
R0096:Itih5 UTSW 2 10251378 missense probably benign 0.02
R0158:Itih5 UTSW 2 10234992 splice site probably benign
R0270:Itih5 UTSW 2 10251264 missense probably benign 0.38
R0276:Itih5 UTSW 2 10185564 missense possibly damaging 0.80
R0807:Itih5 UTSW 2 10249188 missense probably benign 0.00
R0810:Itih5 UTSW 2 10249188 missense probably benign 0.00
R0903:Itih5 UTSW 2 10249188 missense probably benign 0.00
R0905:Itih5 UTSW 2 10249188 missense probably benign 0.00
R0906:Itih5 UTSW 2 10249188 missense probably benign 0.00
R1104:Itih5 UTSW 2 10251512 missense probably benign 0.03
R1397:Itih5 UTSW 2 10240807 missense probably benign 0.14
R1671:Itih5 UTSW 2 10186971 missense probably benign 0.03
R1971:Itih5 UTSW 2 10238568 missense probably damaging 1.00
R3684:Itih5 UTSW 2 10238624 missense possibly damaging 0.93
R3685:Itih5 UTSW 2 10238624 missense possibly damaging 0.93
R3831:Itih5 UTSW 2 10251270 missense possibly damaging 0.95
R3934:Itih5 UTSW 2 10245544 missense probably damaging 0.98
R4670:Itih5 UTSW 2 10190369 missense probably benign 0.01
R4803:Itih5 UTSW 2 10240581 missense probably benign
R4950:Itih5 UTSW 2 10235081 missense probably damaging 0.98
R5020:Itih5 UTSW 2 10240504 intron probably null
R5735:Itih5 UTSW 2 10240761 missense probably benign 0.00
R6454:Itih5 UTSW 2 10240668 missense probably benign
R7019:Itih5 UTSW 2 10190327 missense probably damaging 1.00
R7068:Itih5 UTSW 2 10249304 missense probably damaging 0.99
R7246:Itih5 UTSW 2 10187062 splice site probably null
R7424:Itih5 UTSW 2 10245637 missense probably damaging 1.00
R7452:Itih5 UTSW 2 10238796 missense probably damaging 1.00
R7597:Itih5 UTSW 2 10249376 missense probably damaging 1.00
R8025:Itih5 UTSW 2 10241022
X0026:Itih5 UTSW 2 10238559 splice site probably null
Predicted Primers PCR Primer
(F):5'- TCACGTGCCTTTTGGAGAGG -3'
(R):5'- ATGTAGAAGCCCAGGTGGTC -3'

Sequencing Primer
(F):5'- CCTTTTGGAGAGGCAGTTCATG -3'
(R):5'- CCAGGTGGTCTCTCTGGAAG -3'
Posted On2018-07-24