Incidental Mutation 'R6662:Il1rn'
ID528003
Institutional Source Beutler Lab
Gene Symbol Il1rn
Ensembl Gene ENSMUSG00000026981
Gene Nameinterleukin 1 receptor antagonist
SynonymsF630041P17Rik, IL-1ra
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R6662 (G1)
Quality Score86.0076
Status Validated
Chromosome2
Chromosomal Location24336853-24351494 bp(+) (GRCm38)
Type of Mutationstart gained
DNA Base Change (assembly) A to T at 24336875 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000141269 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114487] [ENSMUST00000142093]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000114486
SMART Domains Protein: ENSMUSP00000110130
Gene: ENSMUSG00000026981

DomainStartEndE-ValueType
IL1 16 157 2.88e-70 SMART
Predicted Effect probably null
Transcript: ENSMUST00000114487
SMART Domains Protein: ENSMUSP00000110131
Gene: ENSMUSG00000026981

DomainStartEndE-ValueType
IL1 15 156 2.88e-70 SMART
Predicted Effect probably null
Transcript: ENSMUST00000142093
SMART Domains Protein: ENSMUSP00000141269
Gene: ENSMUSG00000026981

DomainStartEndE-ValueType
PDB:1IRP|A 8 50 1e-21 PDB
Blast:IL1 15 50 9e-20 BLAST
SCOP:d1ilr1_ 16 50 3e-12 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the interleukin 1 cytokine family. This protein inhibits the activities of interleukin 1, alpha (IL1A) and interleukin 1, beta (IL1B), and modulates a variety of interleukin 1 related immune and inflammatory responses. This gene and five other closely related cytokine genes form a gene cluster spanning approximately 400 kb on chromosome 2. A polymorphism of this gene is reported to be associated with increased risk of osteoporotic fractures and gastric cancer. Several alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jan 2016]
PHENOTYPE: Nullizygous mutations of this gene may result in decreased body weight, increased inflammatory response to turpentine and LPS, decreased susceptibility to bacterial infection, psoriasis, aortitis, rheumatoid arthritis, and abnormal dendritic and CD4-positive T cell morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 A G 19: 57,073,853 probably null Het
Acox1 A G 11: 116,175,323 Y418H probably damaging Het
Akr1b3 C T 6: 34,310,004 V206M possibly damaging Het
Aldh3a1 G A 11: 61,214,655 V196I probably benign Het
Aox3 A G 1: 58,118,615 K44E probably damaging Het
Bad T A 19: 6,951,070 probably benign Het
BC034090 G T 1: 155,226,339 Q60K possibly damaging Het
Casp6 A G 3: 129,912,226 T181A probably benign Het
Catsperg2 G A 7: 29,719,513 probably benign Het
Ccdc14 T C 16: 34,690,794 L46P probably damaging Het
Ces1b A G 8: 93,064,069 L364S probably benign Het
Cfap45 T C 1: 172,529,850 I15T probably benign Het
D730048I06Rik C A 9: 35,790,000 R6M possibly damaging Het
Dph5 G A 3: 115,928,556 E228K probably benign Het
Fat4 G T 3: 38,956,821 L2023F possibly damaging Het
Garem1 T C 18: 21,148,247 N351D probably benign Het
Gm14124 G A 2: 150,266,252 probably null Het
Grm2 C T 9: 106,648,053 A488T probably benign Het
Ifit3b A G 19: 34,611,937 E171G probably damaging Het
Itih5 A T 2: 10,249,181 I748F probably benign Het
Kcnh5 C A 12: 75,007,611 D520Y probably damaging Het
Mgat5 C A 1: 127,469,237 H574N probably damaging Het
Moxd1 A C 10: 24,284,760 D437A probably damaging Het
Mybpc2 A G 7: 44,506,166 F888L probably benign Het
Ncs1 T A 2: 31,287,360 L183Q probably damaging Het
Neto2 A T 8: 85,663,215 D206E probably damaging Het
Omp A G 7: 98,145,339 L27P probably damaging Het
Oxsm A G 14: 16,242,287 S161P probably benign Het
Pde4b A G 4: 102,601,898 I381M possibly damaging Het
Pramel5 A T 4: 144,273,105 N137K probably benign Het
Prss33 T C 17: 23,833,960 S247G probably damaging Het
Rassf9 T A 10: 102,546,038 L425Q possibly damaging Het
Setx A T 2: 29,158,114 D1909V probably damaging Het
Slc26a3 A T 12: 31,457,346 K402* probably null Het
Slco1a6 G A 6: 142,133,215 T118I probably damaging Het
Syne1 A G 10: 5,128,416 L6769P probably damaging Het
Tas2r107 A T 6: 131,659,489 V199D possibly damaging Het
Tchp A G 5: 114,720,015 probably null Het
Trdn A T 10: 33,474,487 N684I probably damaging Het
Trio G T 15: 27,854,996 T700K probably benign Het
Ttn C T 2: 76,755,898 V20084I probably benign Het
Ubl3 A T 5: 148,509,306 Y62* probably null Het
Uckl1 A G 2: 181,573,260 Y267H possibly damaging Het
Zfp786 T C 6: 47,826,986 N41D probably damaging Het
Zfp983 T C 17: 21,662,085 S310P probably damaging Het
Other mutations in Il1rn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01516:Il1rn APN 2 24349539 missense probably damaging 1.00
IGL02606:Il1rn APN 2 24345450 intron probably benign
R1251:Il1rn UTSW 2 24345570 missense probably damaging 1.00
R1943:Il1rn UTSW 2 24348599 missense possibly damaging 0.94
R4284:Il1rn UTSW 2 24349545 missense probably damaging 0.96
R4285:Il1rn UTSW 2 24349545 missense probably damaging 0.96
R4287:Il1rn UTSW 2 24349545 missense probably damaging 0.96
R5317:Il1rn UTSW 2 24349542 missense probably benign 0.30
R5322:Il1rn UTSW 2 24348629 critical splice donor site probably null
R7427:Il1rn UTSW 2 24349542 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- GGCTTCTGCTAGACTGAGTC -3'
(R):5'- GGCCAGATTTTCCTGATAGCC -3'

Sequencing Primer
(F):5'- TAGACTGAGTCACGCCTCTG -3'
(R):5'- CATTGAGCATTGAGTCAACACTAGCG -3'
Posted On2018-07-24