Incidental Mutation 'R6662:Ncs1'
ID 528005
Institutional Source Beutler Lab
Gene Symbol Ncs1
Ensembl Gene ENSMUSG00000062661
Gene Name neuronal calcium sensor 1
Synonyms 9430075O15Rik, Freq, NCS-1, A730032G13Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.118) question?
Stock # R6662 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 31245823-31295989 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 31287360 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 183 (L183Q)
Ref Sequence ENSEMBL: ENSMUSP00000000199 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000199] [ENSMUST00000150670]
AlphaFold Q8BNY6
Predicted Effect probably damaging
Transcript: ENSMUST00000000199
AA Change: L183Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000000199
Gene: ENSMUSG00000062661
AA Change: L183Q

DomainStartEndE-ValueType
EFh 64 92 1.9e-2 SMART
EFh 100 128 3.76e-6 SMART
EFh 148 176 3.4e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000150670
SMART Domains Protein: ENSMUSP00000142269
Gene: ENSMUSG00000062661

DomainStartEndE-ValueType
PDB:4OV2|D 1 28 6e-8 PDB
SCOP:d1fpwa_ 1 28 1e-4 SMART
low complexity region 37 57 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the neuronal calcium sensor gene family, which encode calcium-binding proteins expressed predominantly in neurons. The protein encoded by this gene regulates G protein-coupled receptor phosphorylation in a calcium-dependent manner and can substitute for calmodulin. The protein is associated with secretory granules and modulates synaptic transmission and synaptic plasticity. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 A G 19: 57,073,853 probably null Het
Acox1 A G 11: 116,175,323 Y418H probably damaging Het
Akr1b3 C T 6: 34,310,004 V206M possibly damaging Het
Aldh3a1 G A 11: 61,214,655 V196I probably benign Het
Aox3 A G 1: 58,118,615 K44E probably damaging Het
Bad T A 19: 6,951,070 probably benign Het
BC034090 G T 1: 155,226,339 Q60K possibly damaging Het
Casp6 A G 3: 129,912,226 T181A probably benign Het
Catsperg2 G A 7: 29,719,513 probably benign Het
Ccdc14 T C 16: 34,690,794 L46P probably damaging Het
Ces1b A G 8: 93,064,069 L364S probably benign Het
Cfap45 T C 1: 172,529,850 I15T probably benign Het
D730048I06Rik C A 9: 35,790,000 R6M possibly damaging Het
Dph5 G A 3: 115,928,556 E228K probably benign Het
Fat4 G T 3: 38,956,821 L2023F possibly damaging Het
Garem1 T C 18: 21,148,247 N351D probably benign Het
Gm14124 G A 2: 150,266,252 probably null Het
Grm2 C T 9: 106,648,053 A488T probably benign Het
Ifit3b A G 19: 34,611,937 E171G probably damaging Het
Il1rn A T 2: 24,336,875 probably null Het
Itih5 A T 2: 10,249,181 I748F probably benign Het
Kcnh5 C A 12: 75,007,611 D520Y probably damaging Het
Mgat5 C A 1: 127,469,237 H574N probably damaging Het
Moxd1 A C 10: 24,284,760 D437A probably damaging Het
Mybpc2 A G 7: 44,506,166 F888L probably benign Het
Neto2 A T 8: 85,663,215 D206E probably damaging Het
Omp A G 7: 98,145,339 L27P probably damaging Het
Oxsm A G 14: 16,242,287 S161P probably benign Het
Pde4b A G 4: 102,601,898 I381M possibly damaging Het
Pramel5 A T 4: 144,273,105 N137K probably benign Het
Prss33 T C 17: 23,833,960 S247G probably damaging Het
Rassf9 T A 10: 102,546,038 L425Q possibly damaging Het
Setx A T 2: 29,158,114 D1909V probably damaging Het
Slc26a3 A T 12: 31,457,346 K402* probably null Het
Slco1a6 G A 6: 142,133,215 T118I probably damaging Het
Syne1 A G 10: 5,128,416 L6769P probably damaging Het
Tas2r107 A T 6: 131,659,489 V199D possibly damaging Het
Tchp A G 5: 114,720,015 probably null Het
Trdn A T 10: 33,474,487 N684I probably damaging Het
Trio G T 15: 27,854,996 T700K probably benign Het
Ttn C T 2: 76,755,898 V20084I probably benign Het
Ubl3 A T 5: 148,509,306 Y62* probably null Het
Uckl1 A G 2: 181,573,260 Y267H possibly damaging Het
Zfp786 T C 6: 47,826,986 N41D probably damaging Het
Zfp983 T C 17: 21,662,085 S310P probably damaging Het
Other mutations in Ncs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02021:Ncs1 APN 2 31284165 missense probably damaging 1.00
R1245:Ncs1 UTSW 2 31284693 missense probably benign 0.23
R2853:Ncs1 UTSW 2 31287317 missense probably damaging 0.98
R2983:Ncs1 UTSW 2 31284696 missense probably damaging 1.00
R5474:Ncs1 UTSW 2 31280784 missense probably damaging 1.00
R5813:Ncs1 UTSW 2 31280654 splice site probably null
R7913:Ncs1 UTSW 2 31287284 splice site probably null
R8812:Ncs1 UTSW 2 31284201 missense probably damaging 1.00
R8836:Ncs1 UTSW 2 31246147 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TCTGATGCTGTCTGCTCGAC -3'
(R):5'- TTTCTTTTCAAGCTTACCAGAGGC -3'

Sequencing Primer
(F):5'- TCCTCTGAAGACCCACTTAGATTCAG -3'
(R):5'- CAGAGGCTGGATTTGGGCTTAC -3'
Posted On 2018-07-24