Incidental Mutation 'R6662:Gm14124'
ID 528007
Institutional Source Beutler Lab
Gene Symbol Gm14124
Ensembl Gene ENSMUSG00000079008
Gene Name predicted gene 14124
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.065) question?
Stock # R6662 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 150257517-150270300 bp(+) (GRCm38)
Type of Mutation critical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 150266252 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000105548 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109922]
AlphaFold A2AU83
Predicted Effect probably null
Transcript: ENSMUST00000109922
SMART Domains Protein: ENSMUSP00000105548
Gene: ENSMUSG00000079008

DomainStartEndE-ValueType
KRAB 4 66 9.26e-19 SMART
ZnF_C2H2 103 125 7.49e-5 SMART
ZnF_C2H2 131 151 9.46e0 SMART
ZnF_C2H2 159 181 5.9e-3 SMART
ZnF_C2H2 187 209 6.67e-2 SMART
ZnF_C2H2 215 237 4.87e-4 SMART
ZnF_C2H2 243 265 2.82e0 SMART
ZnF_C2H2 271 293 2.2e2 SMART
ZnF_C2H2 299 321 1.4e-4 SMART
ZnF_C2H2 327 349 1.6e-4 SMART
ZnF_C2H2 355 377 1.18e-2 SMART
ZnF_C2H2 383 405 1.38e-3 SMART
ZnF_C2H2 411 433 9.56e1 SMART
ZnF_C2H2 439 461 6.99e-5 SMART
ZnF_C2H2 467 489 2.99e-4 SMART
ZnF_C2H2 495 517 7.78e-3 SMART
ZnF_C2H2 523 545 1.04e-3 SMART
ZnF_C2H2 551 573 1.6e-4 SMART
ZnF_C2H2 579 601 1.18e-2 SMART
ZnF_C2H2 607 629 4.54e-4 SMART
ZnF_C2H2 635 657 4.24e-4 SMART
ZnF_C2H2 663 685 1.2e-3 SMART
ZnF_C2H2 691 713 8.47e-4 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 100% (46/46)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 A G 19: 57,073,853 probably null Het
Acox1 A G 11: 116,175,323 Y418H probably damaging Het
Akr1b3 C T 6: 34,310,004 V206M possibly damaging Het
Aldh3a1 G A 11: 61,214,655 V196I probably benign Het
Aox3 A G 1: 58,118,615 K44E probably damaging Het
Bad T A 19: 6,951,070 probably benign Het
BC034090 G T 1: 155,226,339 Q60K possibly damaging Het
Casp6 A G 3: 129,912,226 T181A probably benign Het
Catsperg2 G A 7: 29,719,513 probably benign Het
Ccdc14 T C 16: 34,690,794 L46P probably damaging Het
Ces1b A G 8: 93,064,069 L364S probably benign Het
Cfap45 T C 1: 172,529,850 I15T probably benign Het
D730048I06Rik C A 9: 35,790,000 R6M possibly damaging Het
Dph5 G A 3: 115,928,556 E228K probably benign Het
Fat4 G T 3: 38,956,821 L2023F possibly damaging Het
Garem1 T C 18: 21,148,247 N351D probably benign Het
Grm2 C T 9: 106,648,053 A488T probably benign Het
Ifit3b A G 19: 34,611,937 E171G probably damaging Het
Il1rn A T 2: 24,336,875 probably null Het
Itih5 A T 2: 10,249,181 I748F probably benign Het
Kcnh5 C A 12: 75,007,611 D520Y probably damaging Het
Mgat5 C A 1: 127,469,237 H574N probably damaging Het
Moxd1 A C 10: 24,284,760 D437A probably damaging Het
Mybpc2 A G 7: 44,506,166 F888L probably benign Het
Ncs1 T A 2: 31,287,360 L183Q probably damaging Het
Neto2 A T 8: 85,663,215 D206E probably damaging Het
Omp A G 7: 98,145,339 L27P probably damaging Het
Oxsm A G 14: 16,242,287 S161P probably benign Het
Pde4b A G 4: 102,601,898 I381M possibly damaging Het
Pramel5 A T 4: 144,273,105 N137K probably benign Het
Prss33 T C 17: 23,833,960 S247G probably damaging Het
Rassf9 T A 10: 102,546,038 L425Q possibly damaging Het
Setx A T 2: 29,158,114 D1909V probably damaging Het
Slc26a3 A T 12: 31,457,346 K402* probably null Het
Slco1a6 G A 6: 142,133,215 T118I probably damaging Het
Syne1 A G 10: 5,128,416 L6769P probably damaging Het
Tas2r107 A T 6: 131,659,489 V199D possibly damaging Het
Tchp A G 5: 114,720,015 probably null Het
Trdn A T 10: 33,474,487 N684I probably damaging Het
Trio G T 15: 27,854,996 T700K probably benign Het
Ttn C T 2: 76,755,898 V20084I probably benign Het
Ubl3 A T 5: 148,509,306 Y62* probably null Het
Uckl1 A G 2: 181,573,260 Y267H possibly damaging Het
Zfp786 T C 6: 47,826,986 N41D probably damaging Het
Zfp983 T C 17: 21,662,085 S310P probably damaging Het
Other mutations in Gm14124
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01550:Gm14124 APN 2 150266443 splice site probably benign
R0220:Gm14124 UTSW 2 150268675 missense unknown
R0396:Gm14124 UTSW 2 150268053 missense probably damaging 1.00
R0402:Gm14124 UTSW 2 150269216 missense possibly damaging 0.93
R0446:Gm14124 UTSW 2 150268073 missense possibly damaging 0.71
R0462:Gm14124 UTSW 2 150269202 missense possibly damaging 0.80
R0507:Gm14124 UTSW 2 150268124 missense possibly damaging 0.69
R0605:Gm14124 UTSW 2 150268603 missense unknown
R0838:Gm14124 UTSW 2 150269300 missense possibly damaging 0.74
R1327:Gm14124 UTSW 2 150266150 missense possibly damaging 0.71
R1405:Gm14124 UTSW 2 150267700 nonsense probably null
R1405:Gm14124 UTSW 2 150267700 nonsense probably null
R2114:Gm14124 UTSW 2 150267899 missense unknown
R2140:Gm14124 UTSW 2 150269361 missense probably benign 0.33
R3683:Gm14124 UTSW 2 150268056 missense probably benign 0.41
R3917:Gm14124 UTSW 2 150266119 splice site probably benign
R4084:Gm14124 UTSW 2 150266202 missense possibly damaging 0.85
R4499:Gm14124 UTSW 2 150269442 missense possibly damaging 0.93
R4683:Gm14124 UTSW 2 150266470 missense possibly damaging 0.53
R4762:Gm14124 UTSW 2 150267629 missense possibly damaging 0.53
R4937:Gm14124 UTSW 2 150268760 missense unknown
R5678:Gm14124 UTSW 2 150268505 nonsense probably null
R5696:Gm14124 UTSW 2 150269474 missense possibly damaging 0.52
R5697:Gm14124 UTSW 2 150269474 missense possibly damaging 0.52
R5698:Gm14124 UTSW 2 150269474 missense possibly damaging 0.52
R5769:Gm14124 UTSW 2 150268278 missense possibly damaging 0.87
R5780:Gm14124 UTSW 2 150266219 missense probably benign 0.05
R5973:Gm14124 UTSW 2 150267935 missense unknown
R6878:Gm14124 UTSW 2 150266486 missense possibly damaging 0.86
R7037:Gm14124 UTSW 2 150266456 missense possibly damaging 0.86
R7081:Gm14124 UTSW 2 150268269 missense possibly damaging 0.66
R7413:Gm14124 UTSW 2 150266161 missense possibly damaging 0.93
R7725:Gm14124 UTSW 2 150268548 missense unknown
R7781:Gm14124 UTSW 2 150267657 missense possibly damaging 0.53
R8197:Gm14124 UTSW 2 150267657 missense possibly damaging 0.53
R8355:Gm14124 UTSW 2 150267956 missense unknown
R8517:Gm14124 UTSW 2 150268123 missense probably benign 0.33
R8812:Gm14124 UTSW 2 150267704 missense possibly damaging 0.83
R9108:Gm14124 UTSW 2 150268049 missense possibly damaging 0.61
R9488:Gm14124 UTSW 2 150268557 missense unknown
R9499:Gm14124 UTSW 2 150267936 missense unknown
R9551:Gm14124 UTSW 2 150267936 missense unknown
R9567:Gm14124 UTSW 2 150267597 missense possibly damaging 0.53
R9646:Gm14124 UTSW 2 150268184 missense probably benign 0.43
R9709:Gm14124 UTSW 2 150268385 missense possibly damaging 0.47
R9719:Gm14124 UTSW 2 150269384 missense possibly damaging 0.74
R9779:Gm14124 UTSW 2 150266144 missense possibly damaging 0.92
X0022:Gm14124 UTSW 2 150267658 missense possibly damaging 0.53
Z1177:Gm14124 UTSW 2 150268317 missense possibly damaging 0.84
Z1177:Gm14124 UTSW 2 150268324 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CTACTGTGTGCTCGGTAGTG -3'
(R):5'- GGCCATATGTTAGACTATTGGGAATT -3'

Sequencing Primer
(F):5'- TCCTCTTCAAGGGGTGTAGAAATGAC -3'
(R):5'- CCGCATTCTCAACGGAAA -3'
Posted On 2018-07-24