Mutagenetix > Incidental Mutations

Incidental Mutation 'R6662:Gm14124'

528007

Institutional Source

Beutler Lab

Gene Symbol

Gm14124

Ensembl Gene

ENSMUSG00000079008

Gene Name

predicted gene 14124

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.064) question?

Stock #

R6662 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

150257517-150270300 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (1 bp from exon)

DNA Base Change (assembly)

G to A at 150266252 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000105548 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000109922]

AlphaFold

A2AU83

Predicted Effect

probably null
Transcript: ENSMUST00000109922

SMART Domains

Protein: ENSMUSP00000105548
Gene: ENSMUSG00000079008

Domain	Start	End	E-Value	Type
KRAB	4	66	9.26e-19	SMART
ZnF_C2H2	103	125	7.49e-5	SMART
ZnF_C2H2	131	151	9.46e0	SMART
ZnF_C2H2	159	181	5.9e-3	SMART
ZnF_C2H2	187	209	6.67e-2	SMART
ZnF_C2H2	215	237	4.87e-4	SMART
ZnF_C2H2	243	265	2.82e0	SMART
ZnF_C2H2	271	293	2.2e2	SMART
ZnF_C2H2	299	321	1.4e-4	SMART
ZnF_C2H2	327	349	1.6e-4	SMART
ZnF_C2H2	355	377	1.18e-2	SMART
ZnF_C2H2	383	405	1.38e-3	SMART
ZnF_C2H2	411	433	9.56e1	SMART
ZnF_C2H2	439	461	6.99e-5	SMART
ZnF_C2H2	467	489	2.99e-4	SMART
ZnF_C2H2	495	517	7.78e-3	SMART
ZnF_C2H2	523	545	1.04e-3	SMART
ZnF_C2H2	551	573	1.6e-4	SMART
ZnF_C2H2	579	601	1.18e-2	SMART
ZnF_C2H2	607	629	4.54e-4	SMART
ZnF_C2H2	635	657	4.24e-4	SMART
ZnF_C2H2	663	685	1.2e-3	SMART
ZnF_C2H2	691	713	8.47e-4	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 94.8%

Validation Efficiency

100% (46/46)

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ablim1	A	G	19: 57,073,853		probably null	Het
Acox1	A	G	11: 116,175,323	Y418H	probably damaging	Het
Akr1b3	C	T	6: 34,310,004	V206M	possibly damaging	Het
Aldh3a1	G	A	11: 61,214,655	V196I	probably benign	Het
Aox3	A	G	1: 58,118,615	K44E	probably damaging	Het
Bad	T	A	19: 6,951,070		probably benign	Het
BC034090	G	T	1: 155,226,339	Q60K	possibly damaging	Het
Casp6	A	G	3: 129,912,226	T181A	probably benign	Het
Catsperg2	G	A	7: 29,719,513		probably benign	Het
Ccdc14	T	C	16: 34,690,794	L46P	probably damaging	Het
Ces1b	A	G	8: 93,064,069	L364S	probably benign	Het
Cfap45	T	C	1: 172,529,850	I15T	probably benign	Het
D730048I06Rik	C	A	9: 35,790,000	R6M	possibly damaging	Het
Dph5	G	A	3: 115,928,556	E228K	probably benign	Het
Fat4	G	T	3: 38,956,821	L2023F	possibly damaging	Het
Garem1	T	C	18: 21,148,247	N351D	probably benign	Het
Grm2	C	T	9: 106,648,053	A488T	probably benign	Het
Ifit3b	A	G	19: 34,611,937	E171G	probably damaging	Het
Il1rn	A	T	2: 24,336,875		probably null	Het
Itih5	A	T	2: 10,249,181	I748F	probably benign	Het
Kcnh5	C	A	12: 75,007,611	D520Y	probably damaging	Het
Mgat5	C	A	1: 127,469,237	H574N	probably damaging	Het
Moxd1	A	C	10: 24,284,760	D437A	probably damaging	Het
Mybpc2	A	G	7: 44,506,166	F888L	probably benign	Het
Ncs1	T	A	2: 31,287,360	L183Q	probably damaging	Het
Neto2	A	T	8: 85,663,215	D206E	probably damaging	Het
Omp	A	G	7: 98,145,339	L27P	probably damaging	Het
Oxsm	A	G	14: 16,242,287	S161P	probably benign	Het
Pde4b	A	G	4: 102,601,898	I381M	possibly damaging	Het
Pramel5	A	T	4: 144,273,105	N137K	probably benign	Het
Prss33	T	C	17: 23,833,960	S247G	probably damaging	Het
Rassf9	T	A	10: 102,546,038	L425Q	possibly damaging	Het
Setx	A	T	2: 29,158,114	D1909V	probably damaging	Het
Slc26a3	A	T	12: 31,457,346	K402*	probably null	Het
Slco1a6	G	A	6: 142,133,215	T118I	probably damaging	Het
Syne1	A	G	10: 5,128,416	L6769P	probably damaging	Het
Tas2r107	A	T	6: 131,659,489	V199D	possibly damaging	Het
Tchp	A	G	5: 114,720,015		probably null	Het
Trdn	A	T	10: 33,474,487	N684I	probably damaging	Het
Trio	G	T	15: 27,854,996	T700K	probably benign	Het
Ttn	C	T	2: 76,755,898	V20084I	probably benign	Het
Ubl3	A	T	5: 148,509,306	Y62*	probably null	Het
Uckl1	A	G	2: 181,573,260	Y267H	possibly damaging	Het
Zfp786	T	C	6: 47,826,986	N41D	probably damaging	Het
Zfp983	T	C	17: 21,662,085	S310P	probably damaging	Het

Other mutations in Gm14124

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01550:Gm14124	APN	2	150266443	splice site	probably benign
R0220:Gm14124	UTSW	2	150268675	missense	unknown
R0396:Gm14124	UTSW	2	150268053	missense	probably damaging	1.00
R0402:Gm14124	UTSW	2	150269216	missense	possibly damaging	0.93
R0446:Gm14124	UTSW	2	150268073	missense	possibly damaging	0.71
R0462:Gm14124	UTSW	2	150269202	missense	possibly damaging	0.80
R0507:Gm14124	UTSW	2	150268124	missense	possibly damaging	0.69
R0605:Gm14124	UTSW	2	150268603	missense	unknown
R0838:Gm14124	UTSW	2	150269300	missense	possibly damaging	0.74
R1327:Gm14124	UTSW	2	150266150	missense	possibly damaging	0.71
R1405:Gm14124	UTSW	2	150267700	nonsense	probably null
R1405:Gm14124	UTSW	2	150267700	nonsense	probably null
R2114:Gm14124	UTSW	2	150267899	missense	unknown
R2140:Gm14124	UTSW	2	150269361	missense	probably benign	0.33
R3683:Gm14124	UTSW	2	150268056	missense	probably benign	0.41
R3917:Gm14124	UTSW	2	150266119	splice site	probably benign
R4084:Gm14124	UTSW	2	150266202	missense	possibly damaging	0.85
R4499:Gm14124	UTSW	2	150269442	missense	possibly damaging	0.93
R4683:Gm14124	UTSW	2	150266470	missense	possibly damaging	0.53
R4762:Gm14124	UTSW	2	150267629	missense	possibly damaging	0.53
R4937:Gm14124	UTSW	2	150268760	missense	unknown
R5678:Gm14124	UTSW	2	150268505	nonsense	probably null
R5696:Gm14124	UTSW	2	150269474	missense	possibly damaging	0.52
R5697:Gm14124	UTSW	2	150269474	missense	possibly damaging	0.52
R5698:Gm14124	UTSW	2	150269474	missense	possibly damaging	0.52
R5769:Gm14124	UTSW	2	150268278	missense	possibly damaging	0.87
R5780:Gm14124	UTSW	2	150266219	missense	probably benign	0.05
R5973:Gm14124	UTSW	2	150267935	missense	unknown
R6878:Gm14124	UTSW	2	150266486	missense	possibly damaging	0.86
R7037:Gm14124	UTSW	2	150266456	missense	possibly damaging	0.86
R7081:Gm14124	UTSW	2	150268269	missense	possibly damaging	0.66
R7413:Gm14124	UTSW	2	150266161	missense	possibly damaging	0.93
R7725:Gm14124	UTSW	2	150268548	missense	unknown
R7781:Gm14124	UTSW	2	150267657	missense	possibly damaging	0.53
R8197:Gm14124	UTSW	2	150267657	missense	possibly damaging	0.53
R8355:Gm14124	UTSW	2	150267956	missense	unknown
R8517:Gm14124	UTSW	2	150268123	missense	probably benign	0.33
R8812:Gm14124	UTSW	2	150267704	missense	possibly damaging	0.83
R9108:Gm14124	UTSW	2	150268049	missense	possibly damaging	0.61
X0022:Gm14124	UTSW	2	150267658	missense	possibly damaging	0.53
Z1177:Gm14124	UTSW	2	150268317	missense	possibly damaging	0.84
Z1177:Gm14124	UTSW	2	150268324	missense	possibly damaging	0.94

Predicted Primers

PCR Primer
(F):5'- CTACTGTGTGCTCGGTAGTG -3'
(R):5'- GGCCATATGTTAGACTATTGGGAATT -3'

Sequencing Primer
(F):5'- TCCTCTTCAAGGGGTGTAGAAATGAC -3'
(R):5'- CCGCATTCTCAACGGAAA -3'

Posted On

2018-07-24