Mutagenetix > Incidental Mutation

Incidental Mutation 'R6662:Uckl1'

528008

Institutional Source

Beutler Lab

Gene Symbol

Uckl1

Ensembl Gene

ENSMUSG00000089917

Gene Name

uridine-cytidine kinase 1-like 1

Synonyms

Urkl1, 1110007H10Rik

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.337) question?

Stock #

R6662 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

181569149-181584892 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 181573260 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 267 (Y267H)

Ref Sequence

ENSEMBL: ENSMUSP00000121607 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000057816] [ENSMUST00000129469] [ENSMUST00000131949] [ENSMUST00000136875] [ENSMUST00000154613]

AlphaFold

Q91YL3

Predicted Effect

probably benign
Transcript: ENSMUST00000057816
AA Change: Y267H

PolyPhen 2 Score 0.117 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000050398
Gene: ENSMUSG00000089917
AA Change: Y267H

Domain	Start	End	E-Value	Type
low complexity region	2	18	N/A	INTRINSIC
Pfam:CPT	98	249	7e-10	PFAM
Pfam:PRK	100	288	5.7e-61	PFAM
Pfam:UPRTase	326	532	2.6e-74	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124315

Predicted Effect

possibly damaging
Transcript: ENSMUST00000129469
AA Change: Y267H

PolyPhen 2 Score 0.868 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000121607
Gene: ENSMUSG00000089917
AA Change: Y267H

Domain	Start	End	E-Value	Type
low complexity region	2	18	N/A	INTRINSIC
Pfam:CPT	98	210	5.1e-10	PFAM
Pfam:AAA_17	100	251	1.1e-8	PFAM
Pfam:PRK	100	288	3.4e-60	PFAM
Pfam:AAA_18	101	257	5.8e-8	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130893

Predicted Effect

probably benign
Transcript: ENSMUST00000131949

Predicted Effect

probably benign
Transcript: ENSMUST00000134340

SMART Domains

Protein: ENSMUSP00000122098
Gene: ENSMUSG00000089917

Domain	Start	End	E-Value	Type
Pfam:UPRTase	1	182	9.8e-63	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000136875

SMART Domains

Protein: ENSMUSP00000114821
Gene: ENSMUSG00000089917

Domain	Start	End	E-Value	Type
Pfam:CPT	83	211	2.3e-10	PFAM
Pfam:AAA_17	85	235	4.9e-9	PFAM
Pfam:PRK	85	235	8.4e-47	PFAM
Pfam:AAA_18	86	235	2.7e-8	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136997

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138408

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142296

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142491

Predicted Effect

unknown
Transcript: ENSMUST00000144856
AA Change: Y251H

SMART Domains

Protein: ENSMUSP00000114982
Gene: ENSMUSG00000089917
AA Change: Y251H

Domain	Start	End	E-Value	Type
low complexity region	1	12	N/A	INTRINSIC
Pfam:CPT	83	211	2.7e-10	PFAM
Pfam:PRK	85	253	7.7e-56	PFAM
Pfam:AAA_17	86	240	2.5e-8	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149332

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146823

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155182

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156998

Predicted Effect

probably benign
Transcript: ENSMUST00000154613

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156308

Meta Mutation Damage Score

0.9125

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 94.8%

Validation Efficiency

100% (46/46)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a uridine kinase. Uridine kinases catalyze the phosphorylation of uridine to uridine monophosphate. This protein has been shown to bind to Epstein-Barr nuclear antigen 3 as well as natural killer lytic-associated molecule. Ubiquitination of this protein is enhanced by the presence of natural killer lytic-associated molecule. In addition, protein levels decrease in the presence of natural killer lytic-associated molecule, suggesting that association with natural killer lytic-associated molecule results in ubiquitination and subsequent degradation of this protein. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ablim1	A	G	19: 57,073,853		probably null	Het
Acox1	A	G	11: 116,175,323	Y418H	probably damaging	Het
Akr1b3	C	T	6: 34,310,004	V206M	possibly damaging	Het
Aldh3a1	G	A	11: 61,214,655	V196I	probably benign	Het
Aox3	A	G	1: 58,118,615	K44E	probably damaging	Het
Bad	T	A	19: 6,951,070		probably benign	Het
BC034090	G	T	1: 155,226,339	Q60K	possibly damaging	Het
Casp6	A	G	3: 129,912,226	T181A	probably benign	Het
Catsperg2	G	A	7: 29,719,513		probably benign	Het
Ccdc14	T	C	16: 34,690,794	L46P	probably damaging	Het
Ces1b	A	G	8: 93,064,069	L364S	probably benign	Het
Cfap45	T	C	1: 172,529,850	I15T	probably benign	Het
D730048I06Rik	C	A	9: 35,790,000	R6M	possibly damaging	Het
Dph5	G	A	3: 115,928,556	E228K	probably benign	Het
Fat4	G	T	3: 38,956,821	L2023F	possibly damaging	Het
Garem1	T	C	18: 21,148,247	N351D	probably benign	Het
Gm14124	G	A	2: 150,266,252		probably null	Het
Grm2	C	T	9: 106,648,053	A488T	probably benign	Het
Ifit3b	A	G	19: 34,611,937	E171G	probably damaging	Het
Il1rn	A	T	2: 24,336,875		probably null	Het
Itih5	A	T	2: 10,249,181	I748F	probably benign	Het
Kcnh5	C	A	12: 75,007,611	D520Y	probably damaging	Het
Mgat5	C	A	1: 127,469,237	H574N	probably damaging	Het
Moxd1	A	C	10: 24,284,760	D437A	probably damaging	Het
Mybpc2	A	G	7: 44,506,166	F888L	probably benign	Het
Ncs1	T	A	2: 31,287,360	L183Q	probably damaging	Het
Neto2	A	T	8: 85,663,215	D206E	probably damaging	Het
Omp	A	G	7: 98,145,339	L27P	probably damaging	Het
Oxsm	A	G	14: 16,242,287	S161P	probably benign	Het
Pde4b	A	G	4: 102,601,898	I381M	possibly damaging	Het
Pramel5	A	T	4: 144,273,105	N137K	probably benign	Het
Prss33	T	C	17: 23,833,960	S247G	probably damaging	Het
Rassf9	T	A	10: 102,546,038	L425Q	possibly damaging	Het
Setx	A	T	2: 29,158,114	D1909V	probably damaging	Het
Slc26a3	A	T	12: 31,457,346	K402*	probably null	Het
Slco1a6	G	A	6: 142,133,215	T118I	probably damaging	Het
Syne1	A	G	10: 5,128,416	L6769P	probably damaging	Het
Tas2r107	A	T	6: 131,659,489	V199D	possibly damaging	Het
Tchp	A	G	5: 114,720,015		probably null	Het
Trdn	A	T	10: 33,474,487	N684I	probably damaging	Het
Trio	G	T	15: 27,854,996	T700K	probably benign	Het
Ttn	C	T	2: 76,755,898	V20084I	probably benign	Het
Ubl3	A	T	5: 148,509,306	Y62*	probably null	Het
Zfp786	T	C	6: 47,826,986	N41D	probably damaging	Het
Zfp983	T	C	17: 21,662,085	S310P	probably damaging	Het

Other mutations in Uckl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00969:Uckl1	APN	2	181569617	missense	probably benign	0.09
IGL01128:Uckl1	APN	2	181570337	missense	probably damaging	1.00
IGL01325:Uckl1	APN	2	181574961	nonsense	probably null
IGL01767:Uckl1	APN	2	181569534	missense	probably damaging	1.00
IGL02260:Uckl1	APN	2	181569588	missense	probably damaging	1.00
IGL02390:Uckl1	APN	2	181574419	missense	possibly damaging	0.59
IGL03369:Uckl1	APN	2	181570189	missense	probably benign	0.00
R0001:Uckl1	UTSW	2	181574655	missense	probably damaging	1.00
R0528:Uckl1	UTSW	2	181570490	splice site	probably benign
R1037:Uckl1	UTSW	2	181572485	missense	possibly damaging	0.67
R1355:Uckl1	UTSW	2	181573376	missense	probably damaging	1.00
R1416:Uckl1	UTSW	2	181569569	missense	possibly damaging	0.79
R1435:Uckl1	UTSW	2	181573133	missense	probably benign	0.01
R1676:Uckl1	UTSW	2	181574918	missense	probably damaging	1.00
R1723:Uckl1	UTSW	2	181570600	critical splice acceptor site	probably null
R1954:Uckl1	UTSW	2	181570527	missense	probably benign	0.17
R1955:Uckl1	UTSW	2	181570527	missense	probably benign	0.17
R3972:Uckl1	UTSW	2	181574463	missense	probably damaging	0.98
R4664:Uckl1	UTSW	2	181574868	missense	possibly damaging	0.91
R4666:Uckl1	UTSW	2	181574868	missense	possibly damaging	0.91
R5306:Uckl1	UTSW	2	181574367	critical splice donor site	probably null
R5751:Uckl1	UTSW	2	181574452	missense	possibly damaging	0.81
R5758:Uckl1	UTSW	2	181569953	missense	probably damaging	1.00
R6174:Uckl1	UTSW	2	181573073	critical splice donor site	probably null
R6865:Uckl1	UTSW	2	181574493	missense	probably damaging	1.00
R7051:Uckl1	UTSW	2	181574244	missense	probably damaging	1.00
R7643:Uckl1	UTSW	2	181573106	missense	probably benign	0.08
R7818:Uckl1	UTSW	2	181574667	missense	probably damaging	0.97
R8094:Uckl1	UTSW	2	181573256	missense	probably damaging	1.00
R8341:Uckl1	UTSW	2	181569719	missense	probably benign	0.00
R8515:Uckl1	UTSW	2	181574487	missense	probably damaging	1.00
R8980:Uckl1	UTSW	2	181574364	unclassified	probably benign
R9108:Uckl1	UTSW	2	181569500	missense	probably damaging	0.97
R9377:Uckl1	UTSW	2	181569739	missense	probably damaging	1.00
RF014:Uckl1	UTSW	2	181570194	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TTCCAGCTGGCTGTGAACATG -3'
(R):5'- CCTGGCTTCTGTCTGATAGTGC -3'

Sequencing Primer
(F):5'- TGCTGCACAATCAGGTCAATG -3'
(R):5'- CTGTCTGATAGTGCCCCTGG -3'

Posted On

2018-07-24