Incidental Mutation 'R6662:Uckl1'
ID 528008
Institutional Source Beutler Lab
Gene Symbol Uckl1
Ensembl Gene ENSMUSG00000089917
Gene Name uridine-cytidine kinase 1-like 1
Synonyms Urkl1, 1110007H10Rik
MMRRC Submission 044782-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.166) question?
Stock # R6662 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 181210942-181223820 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 181215053 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 267 (Y267H)
Ref Sequence ENSEMBL: ENSMUSP00000121607 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057816] [ENSMUST00000129469] [ENSMUST00000131949] [ENSMUST00000136875] [ENSMUST00000154613]
AlphaFold Q91YL3
Predicted Effect probably benign
Transcript: ENSMUST00000057816
AA Change: Y267H

PolyPhen 2 Score 0.117 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000050398
Gene: ENSMUSG00000089917
AA Change: Y267H

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
Pfam:CPT 98 249 7e-10 PFAM
Pfam:PRK 100 288 5.7e-61 PFAM
Pfam:UPRTase 326 532 2.6e-74 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124315
Predicted Effect possibly damaging
Transcript: ENSMUST00000129469
AA Change: Y267H

PolyPhen 2 Score 0.868 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000121607
Gene: ENSMUSG00000089917
AA Change: Y267H

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
Pfam:CPT 98 210 5.1e-10 PFAM
Pfam:AAA_17 100 251 1.1e-8 PFAM
Pfam:PRK 100 288 3.4e-60 PFAM
Pfam:AAA_18 101 257 5.8e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130893
Predicted Effect probably benign
Transcript: ENSMUST00000131949
Predicted Effect probably benign
Transcript: ENSMUST00000134340
SMART Domains Protein: ENSMUSP00000122098
Gene: ENSMUSG00000089917

DomainStartEndE-ValueType
Pfam:UPRTase 1 182 9.8e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136875
SMART Domains Protein: ENSMUSP00000114821
Gene: ENSMUSG00000089917

DomainStartEndE-ValueType
Pfam:CPT 83 211 2.3e-10 PFAM
Pfam:AAA_17 85 235 4.9e-9 PFAM
Pfam:PRK 85 235 8.4e-47 PFAM
Pfam:AAA_18 86 235 2.7e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136997
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138408
Predicted Effect unknown
Transcript: ENSMUST00000144856
AA Change: Y251H
SMART Domains Protein: ENSMUSP00000114982
Gene: ENSMUSG00000089917
AA Change: Y251H

DomainStartEndE-ValueType
low complexity region 1 12 N/A INTRINSIC
Pfam:CPT 83 211 2.7e-10 PFAM
Pfam:PRK 85 253 7.7e-56 PFAM
Pfam:AAA_17 86 240 2.5e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149332
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146823
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155182
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156998
Predicted Effect probably benign
Transcript: ENSMUST00000154613
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156308
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142491
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142296
Meta Mutation Damage Score 0.9125 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a uridine kinase. Uridine kinases catalyze the phosphorylation of uridine to uridine monophosphate. This protein has been shown to bind to Epstein-Barr nuclear antigen 3 as well as natural killer lytic-associated molecule. Ubiquitination of this protein is enhanced by the presence of natural killer lytic-associated molecule. In addition, protein levels decrease in the presence of natural killer lytic-associated molecule, suggesting that association with natural killer lytic-associated molecule results in ubiquitination and subsequent degradation of this protein. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 A G 19: 57,062,285 (GRCm39) probably null Het
Acox1 A G 11: 116,066,149 (GRCm39) Y418H probably damaging Het
Akr1b1 C T 6: 34,286,939 (GRCm39) V206M possibly damaging Het
Aldh3a1 G A 11: 61,105,481 (GRCm39) V196I probably benign Het
Aox3 A G 1: 58,157,774 (GRCm39) K44E probably damaging Het
Bad T A 19: 6,928,438 (GRCm39) probably benign Het
BC034090 G T 1: 155,102,085 (GRCm39) Q60K possibly damaging Het
Casp6 A G 3: 129,705,875 (GRCm39) T181A probably benign Het
Catsperg2 G A 7: 29,418,938 (GRCm39) probably benign Het
Ccdc14 T C 16: 34,511,164 (GRCm39) L46P probably damaging Het
Ces1b A G 8: 93,790,697 (GRCm39) L364S probably benign Het
Cfap45 T C 1: 172,357,417 (GRCm39) I15T probably benign Het
Dph5 G A 3: 115,722,205 (GRCm39) E228K probably benign Het
Fat4 G T 3: 39,010,970 (GRCm39) L2023F possibly damaging Het
Garem1 T C 18: 21,281,304 (GRCm39) N351D probably benign Het
Grm2 C T 9: 106,525,252 (GRCm39) A488T probably benign Het
Ifit3b A G 19: 34,589,337 (GRCm39) E171G probably damaging Het
Il1rn A T 2: 24,226,887 (GRCm39) probably null Het
Itih5 A T 2: 10,253,992 (GRCm39) I748F probably benign Het
Kcnh5 C A 12: 75,054,385 (GRCm39) D520Y probably damaging Het
Mgat5 C A 1: 127,396,974 (GRCm39) H574N probably damaging Het
Moxd1 A C 10: 24,160,658 (GRCm39) D437A probably damaging Het
Mybpc2 A G 7: 44,155,590 (GRCm39) F888L probably benign Het
Ncs1 T A 2: 31,177,372 (GRCm39) L183Q probably damaging Het
Neto2 A T 8: 86,389,844 (GRCm39) D206E probably damaging Het
Omp A G 7: 97,794,546 (GRCm39) L27P probably damaging Het
Oxsm A G 14: 16,242,287 (GRCm38) S161P probably benign Het
Pate6 C A 9: 35,701,296 (GRCm39) R6M possibly damaging Het
Pde4b A G 4: 102,459,095 (GRCm39) I381M possibly damaging Het
Pramel5 A T 4: 143,999,675 (GRCm39) N137K probably benign Het
Prss33 T C 17: 24,052,934 (GRCm39) S247G probably damaging Het
Rassf9 T A 10: 102,381,899 (GRCm39) L425Q possibly damaging Het
Setx A T 2: 29,048,126 (GRCm39) D1909V probably damaging Het
Slc26a3 A T 12: 31,507,345 (GRCm39) K402* probably null Het
Slco1a6 G A 6: 142,078,941 (GRCm39) T118I probably damaging Het
Syne1 A G 10: 5,078,416 (GRCm39) L6769P probably damaging Het
Tas2r107 A T 6: 131,636,452 (GRCm39) V199D possibly damaging Het
Tchp A G 5: 114,858,076 (GRCm39) probably null Het
Trdn A T 10: 33,350,483 (GRCm39) N684I probably damaging Het
Trio G T 15: 27,855,082 (GRCm39) T700K probably benign Het
Ttn C T 2: 76,586,242 (GRCm39) V20084I probably benign Het
Ubl3 A T 5: 148,446,116 (GRCm39) Y62* probably null Het
Zfp1005 G A 2: 150,108,172 (GRCm39) probably null Het
Zfp786 T C 6: 47,803,920 (GRCm39) N41D probably damaging Het
Zfp983 T C 17: 21,881,001 (GRCm39) S310P probably damaging Het
Other mutations in Uckl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00969:Uckl1 APN 2 181,211,410 (GRCm39) missense probably benign 0.09
IGL01128:Uckl1 APN 2 181,212,130 (GRCm39) missense probably damaging 1.00
IGL01325:Uckl1 APN 2 181,216,754 (GRCm39) nonsense probably null
IGL01767:Uckl1 APN 2 181,211,327 (GRCm39) missense probably damaging 1.00
IGL02260:Uckl1 APN 2 181,211,381 (GRCm39) missense probably damaging 1.00
IGL02390:Uckl1 APN 2 181,216,212 (GRCm39) missense possibly damaging 0.59
IGL03369:Uckl1 APN 2 181,211,982 (GRCm39) missense probably benign 0.00
R0001:Uckl1 UTSW 2 181,216,448 (GRCm39) missense probably damaging 1.00
R0528:Uckl1 UTSW 2 181,212,283 (GRCm39) splice site probably benign
R1037:Uckl1 UTSW 2 181,214,278 (GRCm39) missense possibly damaging 0.67
R1355:Uckl1 UTSW 2 181,215,169 (GRCm39) missense probably damaging 1.00
R1416:Uckl1 UTSW 2 181,211,362 (GRCm39) missense possibly damaging 0.79
R1435:Uckl1 UTSW 2 181,214,926 (GRCm39) missense probably benign 0.01
R1676:Uckl1 UTSW 2 181,216,711 (GRCm39) missense probably damaging 1.00
R1723:Uckl1 UTSW 2 181,212,393 (GRCm39) critical splice acceptor site probably null
R1954:Uckl1 UTSW 2 181,212,320 (GRCm39) missense probably benign 0.17
R1955:Uckl1 UTSW 2 181,212,320 (GRCm39) missense probably benign 0.17
R3972:Uckl1 UTSW 2 181,216,256 (GRCm39) missense probably damaging 0.98
R4664:Uckl1 UTSW 2 181,216,661 (GRCm39) missense possibly damaging 0.91
R4666:Uckl1 UTSW 2 181,216,661 (GRCm39) missense possibly damaging 0.91
R5306:Uckl1 UTSW 2 181,216,160 (GRCm39) critical splice donor site probably null
R5751:Uckl1 UTSW 2 181,216,245 (GRCm39) missense possibly damaging 0.81
R5758:Uckl1 UTSW 2 181,211,746 (GRCm39) missense probably damaging 1.00
R6174:Uckl1 UTSW 2 181,214,866 (GRCm39) critical splice donor site probably null
R6865:Uckl1 UTSW 2 181,216,286 (GRCm39) missense probably damaging 1.00
R7051:Uckl1 UTSW 2 181,216,037 (GRCm39) missense probably damaging 1.00
R7643:Uckl1 UTSW 2 181,214,899 (GRCm39) missense probably benign 0.08
R7818:Uckl1 UTSW 2 181,216,460 (GRCm39) missense probably damaging 0.97
R8094:Uckl1 UTSW 2 181,215,049 (GRCm39) missense probably damaging 1.00
R8341:Uckl1 UTSW 2 181,211,512 (GRCm39) missense probably benign 0.00
R8515:Uckl1 UTSW 2 181,216,280 (GRCm39) missense probably damaging 1.00
R8980:Uckl1 UTSW 2 181,216,157 (GRCm39) unclassified probably benign
R9108:Uckl1 UTSW 2 181,211,293 (GRCm39) missense probably damaging 0.97
R9377:Uckl1 UTSW 2 181,211,532 (GRCm39) missense probably damaging 1.00
RF014:Uckl1 UTSW 2 181,211,987 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TTCCAGCTGGCTGTGAACATG -3'
(R):5'- CCTGGCTTCTGTCTGATAGTGC -3'

Sequencing Primer
(F):5'- TGCTGCACAATCAGGTCAATG -3'
(R):5'- CTGTCTGATAGTGCCCCTGG -3'
Posted On 2018-07-24