Incidental Mutation 'R6662:Casp6'
ID 528011
Institutional Source Beutler Lab
Gene Symbol Casp6
Ensembl Gene ENSMUSG00000027997
Gene Name caspase 6
Synonyms mCASP-6, Mch2
MMRRC Submission 044782-MU
Accession Numbers

Ncbi RefSeq: NM_009811.3; MGI: 1312921
Essential gene? Possibly non essential (E-score: 0.297) question?
Stock # R6662 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 129901425-129914103 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 129912226 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 181 (T181A)
Ref Sequence ENSEMBL: ENSMUSP00000029626 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029624] [ENSMUST00000029626] [ENSMUST00000153506]
AlphaFold O08738
Predicted Effect probably benign
Transcript: ENSMUST00000029624
SMART Domains Protein: ENSMUSP00000029624
Gene: ENSMUSG00000027994

DomainStartEndE-ValueType
Pfam:MCU 109 314 4.4e-68 PFAM
low complexity region 323 335 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000029626
AA Change: T181A

PolyPhen 2 Score 0.224 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000029626
Gene: ENSMUSG00000027997
AA Change: T181A

DomainStartEndE-ValueType
CASc 19 272 6.84e-132 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137314
Predicted Effect probably benign
Transcript: ENSMUST00000146340
SMART Domains Protein: ENSMUSP00000115224
Gene: ENSMUSG00000027994

DomainStartEndE-ValueType
Pfam:MCU 34 149 2.4e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152622
Predicted Effect probably benign
Transcript: ENSMUST00000153506
SMART Domains Protein: ENSMUSP00000118170
Gene: ENSMUSG00000027994

DomainStartEndE-ValueType
low complexity region 178 202 N/A INTRINSIC
Meta Mutation Damage Score 0.0850 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: This gene encodes a member of the cysteine proteases that plays important roles in regulating apoptosis and neurodegeneration. The encoded protein is involved in the transmission of pain and axonal degeneration. Genetic deletion of this gene in mice results in the delay of axon pruning and protects from axon degeneration. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit failure to induce increased lysis of fluorogenic substrate VEID-AMC in staurosporine treated of lenses. Mice homozygous for a different knock-out allele exhibit resistance to excitotoxicity and axonal degeneration. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted(5) Gene trapped(1)
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 A G 19: 57,073,853 probably null Het
Acox1 A G 11: 116,175,323 Y418H probably damaging Het
Akr1b3 C T 6: 34,310,004 V206M possibly damaging Het
Aldh3a1 G A 11: 61,214,655 V196I probably benign Het
Aox3 A G 1: 58,118,615 K44E probably damaging Het
Bad T A 19: 6,951,070 probably benign Het
BC034090 G T 1: 155,226,339 Q60K possibly damaging Het
Catsperg2 G A 7: 29,719,513 probably benign Het
Ccdc14 T C 16: 34,690,794 L46P probably damaging Het
Ces1b A G 8: 93,064,069 L364S probably benign Het
Cfap45 T C 1: 172,529,850 I15T probably benign Het
D730048I06Rik C A 9: 35,790,000 R6M possibly damaging Het
Dph5 G A 3: 115,928,556 E228K probably benign Het
Fat4 G T 3: 38,956,821 L2023F possibly damaging Het
Garem1 T C 18: 21,148,247 N351D probably benign Het
Gm14124 G A 2: 150,266,252 probably null Het
Grm2 C T 9: 106,648,053 A488T probably benign Het
Ifit3b A G 19: 34,611,937 E171G probably damaging Het
Il1rn A T 2: 24,336,875 probably null Het
Itih5 A T 2: 10,249,181 I748F probably benign Het
Kcnh5 C A 12: 75,007,611 D520Y probably damaging Het
Mgat5 C A 1: 127,469,237 H574N probably damaging Het
Moxd1 A C 10: 24,284,760 D437A probably damaging Het
Mybpc2 A G 7: 44,506,166 F888L probably benign Het
Ncs1 T A 2: 31,287,360 L183Q probably damaging Het
Neto2 A T 8: 85,663,215 D206E probably damaging Het
Omp A G 7: 98,145,339 L27P probably damaging Het
Oxsm A G 14: 16,242,287 S161P probably benign Het
Pde4b A G 4: 102,601,898 I381M possibly damaging Het
Pramel5 A T 4: 144,273,105 N137K probably benign Het
Prss33 T C 17: 23,833,960 S247G probably damaging Het
Rassf9 T A 10: 102,546,038 L425Q possibly damaging Het
Setx A T 2: 29,158,114 D1909V probably damaging Het
Slc26a3 A T 12: 31,457,346 K402* probably null Het
Slco1a6 G A 6: 142,133,215 T118I probably damaging Het
Syne1 A G 10: 5,128,416 L6769P probably damaging Het
Tas2r107 A T 6: 131,659,489 V199D possibly damaging Het
Tchp A G 5: 114,720,015 probably null Het
Trdn A T 10: 33,474,487 N684I probably damaging Het
Trio G T 15: 27,854,996 T700K probably benign Het
Ttn C T 2: 76,755,898 V20084I probably benign Het
Ubl3 A T 5: 148,509,306 Y62* probably null Het
Uckl1 A G 2: 181,573,260 Y267H possibly damaging Het
Zfp786 T C 6: 47,826,986 N41D probably damaging Het
Zfp983 T C 17: 21,662,085 S310P probably damaging Het
Other mutations in Casp6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02353:Casp6 APN 3 129910526 missense probably damaging 1.00
IGL02360:Casp6 APN 3 129910526 missense probably damaging 1.00
P0005:Casp6 UTSW 3 129912143 missense probably benign 0.41
R0233:Casp6 UTSW 3 129905975 missense probably damaging 1.00
R0233:Casp6 UTSW 3 129905975 missense probably damaging 1.00
R0277:Casp6 UTSW 3 129910523 missense probably benign 0.22
R4167:Casp6 UTSW 3 129913344 missense probably damaging 1.00
R5297:Casp6 UTSW 3 129910555 missense possibly damaging 0.83
R7605:Casp6 UTSW 3 129912163 missense probably benign
R7653:Casp6 UTSW 3 129912223 missense probably benign 0.00
R7750:Casp6 UTSW 3 129912209 missense probably damaging 1.00
R9497:Casp6 UTSW 3 129905910 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTCTCACGGGAGGTATGCTG -3'
(R):5'- AAAGGACCCCTTCACTGTGATTAG -3'

Sequencing Primer
(F):5'- CGGGAGGTATGCTGAATTACATACTC -3'
(R):5'- CCTTCACTGTGATTAGGCCTGTG -3'
Posted On 2018-07-24