Mutagenetix > Incidental Mutations

Incidental Mutation 'R6662:Pramel5'

528013

Institutional Source

Beutler Lab

Gene Symbol

Pramel5

Ensembl Gene

ENSMUSG00000036749

Gene Name

preferentially expressed antigen in melanoma like 5

Synonyms

OTTMUSG00000010540

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.132) question?

Stock #

R6662 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

144270633-144280488 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 144273105 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 137 (N137K)

Ref Sequence

ENSEMBL: ENSMUSP00000101378 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035757] [ENSMUST00000105752]

AlphaFold

Q7TPY4

Predicted Effect

probably benign
Transcript: ENSMUST00000035757
AA Change: N137K

PolyPhen 2 Score 0.322 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000044222
Gene: ENSMUSG00000036749
AA Change: N137K

Domain	Start	End	E-Value	Type
SCOP:d1a4ya_	224	411	1e-11	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000105752
AA Change: N137K

PolyPhen 2 Score 0.322 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000101378
Gene: ENSMUSG00000036749
AA Change: N137K

Domain	Start	End	E-Value	Type
SCOP:d1a4ya_	224	411	1e-11	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133357

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144127

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 94.8%

Validation Efficiency

100% (46/46)

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ablim1	A	G	19: 57,073,853		probably null	Het
Acox1	A	G	11: 116,175,323	Y418H	probably damaging	Het
Akr1b3	C	T	6: 34,310,004	V206M	possibly damaging	Het
Aldh3a1	G	A	11: 61,214,655	V196I	probably benign	Het
Aox3	A	G	1: 58,118,615	K44E	probably damaging	Het
Bad	T	A	19: 6,951,070		probably benign	Het
BC034090	G	T	1: 155,226,339	Q60K	possibly damaging	Het
Casp6	A	G	3: 129,912,226	T181A	probably benign	Het
Catsperg2	G	A	7: 29,719,513		probably benign	Het
Ccdc14	T	C	16: 34,690,794	L46P	probably damaging	Het
Ces1b	A	G	8: 93,064,069	L364S	probably benign	Het
Cfap45	T	C	1: 172,529,850	I15T	probably benign	Het
D730048I06Rik	C	A	9: 35,790,000	R6M	possibly damaging	Het
Dph5	G	A	3: 115,928,556	E228K	probably benign	Het
Fat4	G	T	3: 38,956,821	L2023F	possibly damaging	Het
Garem1	T	C	18: 21,148,247	N351D	probably benign	Het
Gm14124	G	A	2: 150,266,252		probably null	Het
Grm2	C	T	9: 106,648,053	A488T	probably benign	Het
Ifit3b	A	G	19: 34,611,937	E171G	probably damaging	Het
Il1rn	A	T	2: 24,336,875		probably null	Het
Itih5	A	T	2: 10,249,181	I748F	probably benign	Het
Kcnh5	C	A	12: 75,007,611	D520Y	probably damaging	Het
Mgat5	C	A	1: 127,469,237	H574N	probably damaging	Het
Moxd1	A	C	10: 24,284,760	D437A	probably damaging	Het
Mybpc2	A	G	7: 44,506,166	F888L	probably benign	Het
Ncs1	T	A	2: 31,287,360	L183Q	probably damaging	Het
Neto2	A	T	8: 85,663,215	D206E	probably damaging	Het
Omp	A	G	7: 98,145,339	L27P	probably damaging	Het
Oxsm	A	G	14: 16,242,287	S161P	probably benign	Het
Pde4b	A	G	4: 102,601,898	I381M	possibly damaging	Het
Prss33	T	C	17: 23,833,960	S247G	probably damaging	Het
Rassf9	T	A	10: 102,546,038	L425Q	possibly damaging	Het
Setx	A	T	2: 29,158,114	D1909V	probably damaging	Het
Slc26a3	A	T	12: 31,457,346	K402*	probably null	Het
Slco1a6	G	A	6: 142,133,215	T118I	probably damaging	Het
Syne1	A	G	10: 5,128,416	L6769P	probably damaging	Het
Tas2r107	A	T	6: 131,659,489	V199D	possibly damaging	Het
Tchp	A	G	5: 114,720,015		probably null	Het
Trdn	A	T	10: 33,474,487	N684I	probably damaging	Het
Trio	G	T	15: 27,854,996	T700K	probably benign	Het
Ttn	C	T	2: 76,755,898	V20084I	probably benign	Het
Ubl3	A	T	5: 148,509,306	Y62*	probably null	Het
Uckl1	A	G	2: 181,573,260	Y267H	possibly damaging	Het
Zfp786	T	C	6: 47,826,986	N41D	probably damaging	Het
Zfp983	T	C	17: 21,662,085	S310P	probably damaging	Het

Other mutations in Pramel5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00336:Pramel5	APN	4	144271621	missense	probably damaging	1.00
IGL00990:Pramel5	APN	4	144273979	missense	probably damaging	1.00
IGL01070:Pramel5	APN	4	144271272	missense	probably damaging	1.00
IGL01298:Pramel5	APN	4	144271162	utr 3 prime	probably benign
IGL01653:Pramel5	APN	4	144273859	missense	probably benign	0.01
IGL02150:Pramel5	APN	4	144273201	missense	possibly damaging	0.93
IGL02278:Pramel5	APN	4	144271551	missense	probably damaging	1.00
IGL02671:Pramel5	APN	4	144273112	missense	probably benign	0.25
IGL02868:Pramel5	APN	4	144271352	missense	probably benign	0.03
IGL02981:Pramel5	APN	4	144272860	missense	probably benign	0.01
R0532:Pramel5	UTSW	4	144272740	missense	probably benign	0.03
R0646:Pramel5	UTSW	4	144271620	missense	probably damaging	1.00
R1328:Pramel5	UTSW	4	144271488	missense	probably damaging	1.00
R1902:Pramel5	UTSW	4	144273863	nonsense	probably null
R2027:Pramel5	UTSW	4	144271704	missense	probably damaging	1.00
R2240:Pramel5	UTSW	4	144272936	nonsense	probably null
R2439:Pramel5	UTSW	4	144273740	missense	probably benign	0.01
R3922:Pramel5	UTSW	4	144273052	missense	probably damaging	1.00
R4470:Pramel5	UTSW	4	144271345	missense	possibly damaging	0.89
R4808:Pramel5	UTSW	4	144272755	missense	probably benign	0.04
R4969:Pramel5	UTSW	4	144271617	missense	probably damaging	1.00
R5195:Pramel5	UTSW	4	144271741	missense	probably benign	0.01
R5198:Pramel5	UTSW	4	144273494	intron	probably benign
R5930:Pramel5	UTSW	4	144272983	missense	probably benign	0.43
R5988:Pramel5	UTSW	4	144273146	missense	possibly damaging	0.46
R6988:Pramel5	UTSW	4	144274007	start gained	probably benign
R7116:Pramel5	UTSW	4	144273881	missense	possibly damaging	0.94
R7638:Pramel5	UTSW	4	144271440	missense	possibly damaging	0.93
R8247:Pramel5	UTSW	4	144272825	missense	probably damaging	1.00
R8993:Pramel5	UTSW	4	144272959	missense	possibly damaging	0.81
R9049:Pramel5	UTSW	4	144273916	missense	probably benign	0.02
X0028:Pramel5	UTSW	4	144272836	missense	probably benign	0.00
Z1176:Pramel5	UTSW	4	144273860	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TTCCTGGATTGAGGCTACAAAAG -3'
(R):5'- TGGGTCATGCAGATTACACATTG -3'

Sequencing Primer
(F):5'- GATTGAGGCTACAAAAGAAAACTTC -3'
(R):5'- GCAGATTACACATTGTGTCTTCTG -3'

Posted On

2018-07-24