Incidental Mutation 'R6662:Tchp'
ID 528014
Institutional Source Beutler Lab
Gene Symbol Tchp
Ensembl Gene ENSMUSG00000002486
Gene Name trichoplein, keratin filament binding
Synonyms A930031F18Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6662 (G1)
Quality Score 130.008
Status Validated
Chromosome 5
Chromosomal Location 114707760-114722327 bp(+) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) A to G at 114720015 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000092009 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094441]
AlphaFold Q3TVW5
Predicted Effect probably null
Transcript: ENSMUST00000094441
SMART Domains Protein: ENSMUSP00000092009
Gene: ENSMUSG00000002486

DomainStartEndE-ValueType
low complexity region 19 35 N/A INTRINSIC
coiled coil region 69 140 N/A INTRINSIC
Pfam:TPH 145 485 1.5e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000112199
SMART Domains Protein: ENSMUSP00000107818
Gene: ENSMUSG00000002486

DomainStartEndE-ValueType
Pfam:Trichoplein 1 233 1.4e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124242
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128625
Predicted Effect probably benign
Transcript: ENSMUST00000131679
SMART Domains Protein: ENSMUSP00000119890
Gene: ENSMUSG00000002486

DomainStartEndE-ValueType
low complexity region 15 39 N/A INTRINSIC
Pfam:TPH 50 215 1.5e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185016
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202252
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202276
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 100% (46/46)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 A G 19: 57,073,853 probably null Het
Acox1 A G 11: 116,175,323 Y418H probably damaging Het
Akr1b3 C T 6: 34,310,004 V206M possibly damaging Het
Aldh3a1 G A 11: 61,214,655 V196I probably benign Het
Aox3 A G 1: 58,118,615 K44E probably damaging Het
Bad T A 19: 6,951,070 probably benign Het
BC034090 G T 1: 155,226,339 Q60K possibly damaging Het
Casp6 A G 3: 129,912,226 T181A probably benign Het
Catsperg2 G A 7: 29,719,513 probably benign Het
Ccdc14 T C 16: 34,690,794 L46P probably damaging Het
Ces1b A G 8: 93,064,069 L364S probably benign Het
Cfap45 T C 1: 172,529,850 I15T probably benign Het
D730048I06Rik C A 9: 35,790,000 R6M possibly damaging Het
Dph5 G A 3: 115,928,556 E228K probably benign Het
Fat4 G T 3: 38,956,821 L2023F possibly damaging Het
Garem1 T C 18: 21,148,247 N351D probably benign Het
Gm14124 G A 2: 150,266,252 probably null Het
Grm2 C T 9: 106,648,053 A488T probably benign Het
Ifit3b A G 19: 34,611,937 E171G probably damaging Het
Il1rn A T 2: 24,336,875 probably null Het
Itih5 A T 2: 10,249,181 I748F probably benign Het
Kcnh5 C A 12: 75,007,611 D520Y probably damaging Het
Mgat5 C A 1: 127,469,237 H574N probably damaging Het
Moxd1 A C 10: 24,284,760 D437A probably damaging Het
Mybpc2 A G 7: 44,506,166 F888L probably benign Het
Ncs1 T A 2: 31,287,360 L183Q probably damaging Het
Neto2 A T 8: 85,663,215 D206E probably damaging Het
Omp A G 7: 98,145,339 L27P probably damaging Het
Oxsm A G 14: 16,242,287 S161P probably benign Het
Pde4b A G 4: 102,601,898 I381M possibly damaging Het
Pramel5 A T 4: 144,273,105 N137K probably benign Het
Prss33 T C 17: 23,833,960 S247G probably damaging Het
Rassf9 T A 10: 102,546,038 L425Q possibly damaging Het
Setx A T 2: 29,158,114 D1909V probably damaging Het
Slc26a3 A T 12: 31,457,346 K402* probably null Het
Slco1a6 G A 6: 142,133,215 T118I probably damaging Het
Syne1 A G 10: 5,128,416 L6769P probably damaging Het
Tas2r107 A T 6: 131,659,489 V199D possibly damaging Het
Trdn A T 10: 33,474,487 N684I probably damaging Het
Trio G T 15: 27,854,996 T700K probably benign Het
Ttn C T 2: 76,755,898 V20084I probably benign Het
Ubl3 A T 5: 148,509,306 Y62* probably null Het
Uckl1 A G 2: 181,573,260 Y267H possibly damaging Het
Zfp786 T C 6: 47,826,986 N41D probably damaging Het
Zfp983 T C 17: 21,662,085 S310P probably damaging Het
Other mutations in Tchp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Tchp APN 5 114708733 missense probably benign 0.00
R0266:Tchp UTSW 5 114709333 missense possibly damaging 0.87
R0454:Tchp UTSW 5 114720182 missense probably benign 0.02
R0709:Tchp UTSW 5 114717453 missense probably damaging 1.00
R0725:Tchp UTSW 5 114719621 missense probably benign 0.04
R2680:Tchp UTSW 5 114709519 critical splice donor site probably null
R4604:Tchp UTSW 5 114719573 splice site probably null
R4956:Tchp UTSW 5 114719620 missense probably damaging 0.99
R6945:Tchp UTSW 5 114709350 missense possibly damaging 0.76
R7002:Tchp UTSW 5 114708796 missense probably benign 0.39
R7288:Tchp UTSW 5 114715569 missense probably damaging 1.00
R7447:Tchp UTSW 5 114715655 missense probably benign 0.00
R8021:Tchp UTSW 5 114718417 missense probably damaging 1.00
R8066:Tchp UTSW 5 114709411 missense probably benign 0.32
R8087:Tchp UTSW 5 114719604 missense probably damaging 1.00
R8403:Tchp UTSW 5 114708766 missense possibly damaging 0.87
R9053:Tchp UTSW 5 114715855 missense probably benign 0.22
R9149:Tchp UTSW 5 114721123 nonsense probably null
R9311:Tchp UTSW 5 114708816 missense probably benign 0.02
R9436:Tchp UTSW 5 114709385 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTGAGTCCAGTCCATTGCTTGC -3'
(R):5'- CTGCAGCAAAGCATTGGAGTG -3'

Sequencing Primer
(F):5'- CATTGCTTGCTTACATCCAAATC -3'
(R):5'- GCATTGGAGTGCTCTTCCGC -3'
Posted On 2018-07-24