Incidental Mutation 'R6662:Akr1b3'
ID528016
Institutional Source Beutler Lab
Gene Symbol Akr1b3
Ensembl Gene ENSMUSG00000001642
Gene Namealdo-keto reductase family 1, member B3 (aldose reductase)
SynonymsAhr-1, Aldor1, Ahr1, ALR2, Aldr1, AR
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.351) question?
Stock #R6662 (G1)
Quality Score111.008
Status Validated
Chromosome6
Chromosomal Location34302434-34317478 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 34310004 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 206 (V206M)
Ref Sequence ENSEMBL: ENSMUSP00000100045 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102980] [ENSMUST00000154655]
Predicted Effect possibly damaging
Transcript: ENSMUST00000102980
AA Change: V206M

PolyPhen 2 Score 0.561 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000100045
Gene: ENSMUSG00000001642
AA Change: V206M

DomainStartEndE-ValueType
Pfam:Aldo_ket_red 13 294 4.1e-56 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126991
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136559
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138275
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142761
Predicted Effect probably benign
Transcript: ENSMUST00000154655
SMART Domains Protein: ENSMUSP00000114391
Gene: ENSMUSG00000001642

DomainStartEndE-ValueType
Pfam:Aldo_ket_red 15 176 9.2e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201392
Meta Mutation Damage Score 0.0747 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the aldo/keto reductase superfamily, which consists of more than 40 known enzymes and proteins. This member catalyzes the reduction of a number of aldehydes, including the aldehyde form of glucose, and is thereby implicated in the development of diabetic complications by catalyzing the reduction of glucose to sorbitol. Multiple pseudogenes have been identified for this gene. The nomenclature system used by the HUGO Gene Nomenclature Committee to define human aldo-keto reductase family members is known to differ from that used by the Mouse Genome Informatics database. [provided by RefSeq, Feb 2009]
PHENOTYPE: Homozygous mutation of this gene results in increased drinking, increased urination, and dilation of the renal tubules. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 A G 19: 57,073,853 probably null Het
Acox1 A G 11: 116,175,323 Y418H probably damaging Het
Aldh3a1 G A 11: 61,214,655 V196I probably benign Het
Aox3 A G 1: 58,118,615 K44E probably damaging Het
Bad T A 19: 6,951,070 probably benign Het
BC034090 G T 1: 155,226,339 Q60K possibly damaging Het
Casp6 A G 3: 129,912,226 T181A probably benign Het
Catsperg2 G A 7: 29,719,513 probably benign Het
Ccdc14 T C 16: 34,690,794 L46P probably damaging Het
Ces1b A G 8: 93,064,069 L364S probably benign Het
Cfap45 T C 1: 172,529,850 I15T probably benign Het
D730048I06Rik C A 9: 35,790,000 R6M possibly damaging Het
Dph5 G A 3: 115,928,556 E228K probably benign Het
Fat4 G T 3: 38,956,821 L2023F possibly damaging Het
Garem1 T C 18: 21,148,247 N351D probably benign Het
Gm14124 G A 2: 150,266,252 probably null Het
Grm2 C T 9: 106,648,053 A488T probably benign Het
Ifit3b A G 19: 34,611,937 E171G probably damaging Het
Il1rn A T 2: 24,336,875 probably null Het
Itih5 A T 2: 10,249,181 I748F probably benign Het
Kcnh5 C A 12: 75,007,611 D520Y probably damaging Het
Mgat5 C A 1: 127,469,237 H574N probably damaging Het
Moxd1 A C 10: 24,284,760 D437A probably damaging Het
Mybpc2 A G 7: 44,506,166 F888L probably benign Het
Ncs1 T A 2: 31,287,360 L183Q probably damaging Het
Neto2 A T 8: 85,663,215 D206E probably damaging Het
Omp A G 7: 98,145,339 L27P probably damaging Het
Oxsm A G 14: 16,242,287 S161P probably benign Het
Pde4b A G 4: 102,601,898 I381M possibly damaging Het
Pramel5 A T 4: 144,273,105 N137K probably benign Het
Prss33 T C 17: 23,833,960 S247G probably damaging Het
Rassf9 T A 10: 102,546,038 L425Q possibly damaging Het
Setx A T 2: 29,158,114 D1909V probably damaging Het
Slc26a3 A T 12: 31,457,346 K402* probably null Het
Slco1a6 G A 6: 142,133,215 T118I probably damaging Het
Syne1 A G 10: 5,128,416 L6769P probably damaging Het
Tas2r107 A T 6: 131,659,489 V199D possibly damaging Het
Tchp A G 5: 114,720,015 probably null Het
Trdn A T 10: 33,474,487 N684I probably damaging Het
Trio G T 15: 27,854,996 T700K probably benign Het
Ttn C T 2: 76,755,898 V20084I probably benign Het
Ubl3 A T 5: 148,509,306 Y62* probably null Het
Uckl1 A G 2: 181,573,260 Y267H possibly damaging Het
Zfp786 T C 6: 47,826,986 N41D probably damaging Het
Zfp983 T C 17: 21,662,085 S310P probably damaging Het
Other mutations in Akr1b3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02806:Akr1b3 APN 6 34304319 missense probably damaging 1.00
R0567:Akr1b3 UTSW 6 34304345 splice site probably null
R0611:Akr1b3 UTSW 6 34309642 missense probably benign 0.02
R1564:Akr1b3 UTSW 6 34306535 splice site probably null
R2445:Akr1b3 UTSW 6 34310934 missense probably benign 0.26
R2507:Akr1b3 UTSW 6 34310064 missense probably damaging 1.00
R4323:Akr1b3 UTSW 6 34310927 missense probably benign 0.00
R4373:Akr1b3 UTSW 6 34304267 utr 3 prime probably benign
R4606:Akr1b3 UTSW 6 34306664 unclassified probably benign
R5513:Akr1b3 UTSW 6 34316646 intron probably benign
R6031:Akr1b3 UTSW 6 34312674 missense probably benign 0.07
R6031:Akr1b3 UTSW 6 34312674 missense probably benign 0.07
R6560:Akr1b3 UTSW 6 34310004 missense possibly damaging 0.56
R6561:Akr1b3 UTSW 6 34310004 missense possibly damaging 0.56
R6632:Akr1b3 UTSW 6 34310004 missense possibly damaging 0.56
R6654:Akr1b3 UTSW 6 34310004 missense possibly damaging 0.56
R6655:Akr1b3 UTSW 6 34310004 missense possibly damaging 0.56
R6657:Akr1b3 UTSW 6 34310004 missense possibly damaging 0.56
R6658:Akr1b3 UTSW 6 34310004 missense possibly damaging 0.56
R8209:Akr1b3 UTSW 6 34311932 missense probably damaging 0.99
R8226:Akr1b3 UTSW 6 34311932 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCAGAAGAATATCCATCTTGTTCC -3'
(R):5'- GCCATCAACTGGGAAATGTGG -3'

Sequencing Primer
(F):5'- TTCCTAGGAACATCAACCTCCCAG -3'
(R):5'- GGGGGAGTTGTTACAGCTTATC -3'
Posted On2018-07-24